ID: 1113062446

View in Genome Browser
Species Human (GRCh38)
Location 13:106337834-106337856
Sequence ACATGGGGCCCTGTCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113062446_1113062451 23 Left 1113062446 13:106337834-106337856 CCAGGACTGACAGGGCCCCATGT No data
Right 1113062451 13:106337880-106337902 AAAAACCACCTGCTGCACAAGGG 0: 2
1: 0
2: 1
3: 17
4: 159
1113062446_1113062452 24 Left 1113062446 13:106337834-106337856 CCAGGACTGACAGGGCCCCATGT No data
Right 1113062452 13:106337881-106337903 AAAACCACCTGCTGCACAAGGGG No data
1113062446_1113062450 22 Left 1113062446 13:106337834-106337856 CCAGGACTGACAGGGCCCCATGT No data
Right 1113062450 13:106337879-106337901 GAAAAACCACCTGCTGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113062446 Original CRISPR ACATGGGGCCCTGTCAGTCC TGG (reversed) Intergenic
No off target data available for this crispr