ID: 1113073334

View in Genome Browser
Species Human (GRCh38)
Location 13:106443848-106443870
Sequence GTCTCCTGGAAAAGCACACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113073334_1113073338 0 Left 1113073334 13:106443848-106443870 CCCCGTGTGCTTTTCCAGGAGAC No data
Right 1113073338 13:106443871-106443893 ATATTATTTAAAACCTATCTAGG No data
1113073334_1113073340 23 Left 1113073334 13:106443848-106443870 CCCCGTGTGCTTTTCCAGGAGAC No data
Right 1113073340 13:106443894-106443916 ACTTCAAGAATGAAAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113073334 Original CRISPR GTCTCCTGGAAAAGCACACG GGG (reversed) Intergenic
No off target data available for this crispr