ID: 1113074493

View in Genome Browser
Species Human (GRCh38)
Location 13:106454547-106454569
Sequence CACCCCAGACAGATGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113074493_1113074499 -9 Left 1113074493 13:106454547-106454569 CCATGGCCCATCTGTCTGGGGTG No data
Right 1113074499 13:106454561-106454583 TCTGGGGTGCTGGGTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113074493 Original CRISPR CACCCCAGACAGATGGGCCA TGG (reversed) Intergenic
No off target data available for this crispr