ID: 1113075908

View in Genome Browser
Species Human (GRCh38)
Location 13:106467962-106467984
Sequence CTGTAAAAGGGAAAGGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113075908_1113075913 10 Left 1113075908 13:106467962-106467984 CCTTCAACCTTTCCCTTTTACAG No data
Right 1113075913 13:106467995-106468017 GCTATTCTTTTAGAAGTCAAAGG No data
1113075908_1113075914 18 Left 1113075908 13:106467962-106467984 CCTTCAACCTTTCCCTTTTACAG No data
Right 1113075914 13:106468003-106468025 TTTAGAAGTCAAAGGAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113075908 Original CRISPR CTGTAAAAGGGAAAGGTTGA AGG (reversed) Intergenic
No off target data available for this crispr