ID: 1113076091

View in Genome Browser
Species Human (GRCh38)
Location 13:106469336-106469358
Sequence CCCGGGTGCCGTGTGTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113076091_1113076104 17 Left 1113076091 13:106469336-106469358 CCTGCAGACACACGGCACCCGGG No data
Right 1113076104 13:106469376-106469398 GCTAATAATTGGGAGTGATAAGG No data
1113076091_1113076101 -5 Left 1113076091 13:106469336-106469358 CCTGCAGACACACGGCACCCGGG No data
Right 1113076101 13:106469354-106469376 CCGGGGAGAGGGGAGGTGACGGG No data
1113076091_1113076105 27 Left 1113076091 13:106469336-106469358 CCTGCAGACACACGGCACCCGGG No data
Right 1113076105 13:106469386-106469408 GGGAGTGATAAGGAGCTGCTAGG No data
1113076091_1113076107 29 Left 1113076091 13:106469336-106469358 CCTGCAGACACACGGCACCCGGG No data
Right 1113076107 13:106469388-106469410 GAGTGATAAGGAGCTGCTAGGGG No data
1113076091_1113076102 6 Left 1113076091 13:106469336-106469358 CCTGCAGACACACGGCACCCGGG No data
Right 1113076102 13:106469365-106469387 GGAGGTGACGGGCTAATAATTGG No data
1113076091_1113076108 30 Left 1113076091 13:106469336-106469358 CCTGCAGACACACGGCACCCGGG No data
Right 1113076108 13:106469389-106469411 AGTGATAAGGAGCTGCTAGGGGG No data
1113076091_1113076099 -6 Left 1113076091 13:106469336-106469358 CCTGCAGACACACGGCACCCGGG No data
Right 1113076099 13:106469353-106469375 CCCGGGGAGAGGGGAGGTGACGG No data
1113076091_1113076106 28 Left 1113076091 13:106469336-106469358 CCTGCAGACACACGGCACCCGGG No data
Right 1113076106 13:106469387-106469409 GGAGTGATAAGGAGCTGCTAGGG No data
1113076091_1113076103 7 Left 1113076091 13:106469336-106469358 CCTGCAGACACACGGCACCCGGG No data
Right 1113076103 13:106469366-106469388 GAGGTGACGGGCTAATAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113076091 Original CRISPR CCCGGGTGCCGTGTGTCTGC AGG (reversed) Intergenic
No off target data available for this crispr