ID: 1113076873

View in Genome Browser
Species Human (GRCh38)
Location 13:106475430-106475452
Sequence TGGCTTAGTCAATCACAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113076873_1113076876 13 Left 1113076873 13:106475430-106475452 CCACTTTGTGATTGACTAAGCCA No data
Right 1113076876 13:106475466-106475488 ATTTTTCATGCTCCTGGCTTAGG No data
1113076873_1113076875 7 Left 1113076873 13:106475430-106475452 CCACTTTGTGATTGACTAAGCCA No data
Right 1113076875 13:106475460-106475482 TCTTGTATTTTTCATGCTCCTGG No data
1113076873_1113076877 19 Left 1113076873 13:106475430-106475452 CCACTTTGTGATTGACTAAGCCA No data
Right 1113076877 13:106475472-106475494 CATGCTCCTGGCTTAGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113076873 Original CRISPR TGGCTTAGTCAATCACAAAG TGG (reversed) Intergenic
No off target data available for this crispr