ID: 1113076874

View in Genome Browser
Species Human (GRCh38)
Location 13:106475450-106475472
Sequence GAAAAATACAAGAATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113076874_1113076877 -1 Left 1113076874 13:106475450-106475472 CCATCTTCATTCTTGTATTTTTC No data
Right 1113076877 13:106475472-106475494 CATGCTCCTGGCTTAGGAGCCGG No data
1113076874_1113076876 -7 Left 1113076874 13:106475450-106475472 CCATCTTCATTCTTGTATTTTTC No data
Right 1113076876 13:106475466-106475488 ATTTTTCATGCTCCTGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113076874 Original CRISPR GAAAAATACAAGAATGAAGA TGG (reversed) Intergenic
No off target data available for this crispr