ID: 1113076877

View in Genome Browser
Species Human (GRCh38)
Location 13:106475472-106475494
Sequence CATGCTCCTGGCTTAGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113076874_1113076877 -1 Left 1113076874 13:106475450-106475472 CCATCTTCATTCTTGTATTTTTC No data
Right 1113076877 13:106475472-106475494 CATGCTCCTGGCTTAGGAGCCGG No data
1113076873_1113076877 19 Left 1113076873 13:106475430-106475452 CCACTTTGTGATTGACTAAGCCA No data
Right 1113076877 13:106475472-106475494 CATGCTCCTGGCTTAGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113076877 Original CRISPR CATGCTCCTGGCTTAGGAGC CGG Intergenic
No off target data available for this crispr