ID: 1113080043

View in Genome Browser
Species Human (GRCh38)
Location 13:106509845-106509867
Sequence CTGTAGGGTGGGTGAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113080038_1113080043 12 Left 1113080038 13:106509810-106509832 CCTTTCTAGGGAAACTTGTAGAT 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1113080043 13:106509845-106509867 CTGTAGGGTGGGTGAGAAATTGG 0: 1
1: 0
2: 2
3: 24
4: 227
1113080036_1113080043 19 Left 1113080036 13:106509803-106509825 CCCATTTCCTTTCTAGGGAAACT 0: 1
1: 0
2: 4
3: 34
4: 311
Right 1113080043 13:106509845-106509867 CTGTAGGGTGGGTGAGAAATTGG 0: 1
1: 0
2: 2
3: 24
4: 227
1113080037_1113080043 18 Left 1113080037 13:106509804-106509826 CCATTTCCTTTCTAGGGAAACTT 0: 1
1: 0
2: 1
3: 42
4: 484
Right 1113080043 13:106509845-106509867 CTGTAGGGTGGGTGAGAAATTGG 0: 1
1: 0
2: 2
3: 24
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113080043 Original CRISPR CTGTAGGGTGGGTGAGAAAT TGG Intronic
900327086 1:2113720-2113742 CTGGGGGGTGGGTGAGAGTTGGG + Intronic
907285763 1:53378474-53378496 CTCTAGTGTGGATGAGCAATGGG + Intergenic
907740430 1:57160463-57160485 CTTGAGGCTGGGTAAGAAATAGG + Intronic
910744647 1:90560350-90560372 CTGAAGAGTGGGTCAGAAAGTGG + Intergenic
911125803 1:94339921-94339943 GTGAAGGGAGGGTGAGAAAGGGG - Intergenic
911255452 1:95628082-95628104 CAGAAGGGTGGAGGAGAAATAGG + Intergenic
911743009 1:101407984-101408006 CTGCAGCGTGGGTAAGAAAAAGG - Intergenic
914885377 1:151580212-151580234 CTGTAGTGAGGGAGAAAAATGGG + Intronic
918500904 1:185195145-185195167 CTGTCGGGTGGTTGAGGGATAGG - Intronic
918672737 1:187240392-187240414 ATGTGGGGTGGGTGGGAAATGGG - Intergenic
918811704 1:189130529-189130551 CTGATGGTTTGGTGAGAAATGGG + Intergenic
919006394 1:191904109-191904131 CTGTAGGGCAGGAGAGAAAGAGG - Intergenic
920234481 1:204493926-204493948 CTGTGGACTGGGTGAGAAGTCGG - Intronic
920406538 1:205717624-205717646 TTGTAGGGAGGGTGGGCAATGGG - Exonic
921352358 1:214249222-214249244 GTGTATGGTGCTTGAGAAATGGG - Intergenic
921701479 1:218273406-218273428 ATTTGGGGTGGGAGAGAAATGGG + Intergenic
921717283 1:218430634-218430656 ATTTAGTGTGGGTGATAAATGGG + Intronic
921997926 1:221441751-221441773 CTGTAGGGGAGGAGAGAAAGAGG + Intergenic
922112438 1:222574106-222574128 CTGGAGGGGTGGGGAGAAATGGG + Intronic
922433408 1:225579135-225579157 CTGTAGGGAGAGGCAGAAATGGG + Intronic
923778645 1:237001842-237001864 ATTTACGGTGGGTGAGAACTTGG + Intergenic
924120314 1:240790718-240790740 CTGTAGGCTCAGTGACAAATGGG - Intronic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
1064957990 10:20932419-20932441 CTGGGGGGTGGGGGAGAAAGGGG + Intronic
1065344454 10:24735521-24735543 ATGTGGGGTGGGAGAGAAAGAGG - Intergenic
1066589895 10:36983504-36983526 GTGGAGGGTGGATGACAAATAGG - Intergenic
1067983238 10:51111588-51111610 CTGAATGGTGGGTGAGAAGAAGG + Intronic
1070704740 10:78629493-78629515 CTGCAGGGTGGGTGAGATTGGGG - Intergenic
1070765035 10:79051507-79051529 CCGTAGGGTCAGTGAGAAAATGG - Intergenic
1070770383 10:79079074-79079096 CTGGAGGGTGGGTTAAAAAGAGG - Intronic
1071468719 10:85963398-85963420 TTGGAGGGTAAGTGAGAAATGGG - Intronic
1073170580 10:101504525-101504547 CAGTGGGGTTGGTGAGAGATGGG - Intronic
1073349944 10:102812648-102812670 CTGTATGGTGGGGGAGGAGTTGG - Exonic
1074176176 10:111005653-111005675 CTGTAGAGTGGGTAAGCAAAAGG - Intronic
1074206146 10:111284611-111284633 CTCTGGGTTGGGTGACAAATTGG - Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1076043119 10:127268585-127268607 GAGAAGGGTGGCTGAGAAATGGG - Intronic
1077977962 11:7269210-7269232 CAGTTGGGGGGGTGGGAAATGGG + Intronic
1078758955 11:14236313-14236335 TTGCAGGGTGGGAGAGAAAGAGG + Intronic
1078999258 11:16737716-16737738 CTGGAGAGAGGGCGAGAAATGGG + Intronic
1079356742 11:19736136-19736158 CTATAGAGAGGGTGAGATATAGG - Intronic
1083054928 11:59810546-59810568 CTGGAGGGTGGGGGAGGAAGAGG + Intronic
1083756096 11:64792352-64792374 GTGTCGTGTGGGTAAGAAATGGG - Exonic
1084947866 11:72648520-72648542 CTGTAGGGTGGGTCAGCCACAGG + Intronic
1085447535 11:76610707-76610729 GTGTAGGGTGGGGGAGAAGTGGG + Intergenic
1085771563 11:79330480-79330502 CTGAATGCTGGGTGAGAAAGAGG - Intronic
1085887672 11:80539183-80539205 ATGTAGGGTGGGGGAAAAGTAGG - Intergenic
1085898181 11:80664542-80664564 GTGTAGGGTGGATGACAAACAGG + Intergenic
1086115157 11:83241824-83241846 CTGTTGGGTGGGTGATAGACTGG + Intronic
1087844511 11:102957062-102957084 CTTTAGGGTGAGTACGAAATGGG + Intergenic
1088934006 11:114380189-114380211 CTTTACTGTGGGAGAGAAATGGG - Intergenic
1089511273 11:118998651-118998673 GTTTGGGGTGGGTGAGAAAAAGG + Intronic
1089977223 11:122742952-122742974 GTGTGTGGTGTGTGAGAAATGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093833965 12:23802888-23802910 CTGTAGTGTGGTTGAGAAGTAGG - Intronic
1093875264 12:24342312-24342334 GTGTAGACTTGGTGAGAAATTGG - Intergenic
1094082934 12:26557238-26557260 CTGTTGGGTAGGTGACCAATAGG - Intronic
1094166517 12:27449047-27449069 CTGCAGGGTGGCTGAGACCTAGG - Intergenic
1094271932 12:28626610-28626632 CTGTTGTGTGGGTGAGGAAGGGG + Intergenic
1096095891 12:48935466-48935488 CTTTAGGGTGGGTGAGGTCTGGG - Intronic
1097183526 12:57184303-57184325 CTGTAGGGTGGGGGTGGAAGTGG - Intronic
1099300368 12:80886940-80886962 CTGAAGGCTGGGGGAGAAGTTGG - Intronic
1100497405 12:95138633-95138655 CAGTGTGGTGGGAGAGAAATGGG - Intronic
1100954904 12:99896233-99896255 ATGAAGGGTGTGGGAGAAATGGG - Intronic
1102577127 12:113862933-113862955 CTGCAGGGTGGGGGAGTAATTGG - Intronic
1102638635 12:114346672-114346694 CTGTAGAGTGGGTGGGGAGTTGG - Intergenic
1103215239 12:119196681-119196703 CTGTAGGGTGGGAGGGAGAAGGG + Intronic
1103840756 12:123862249-123862271 GTGAAGGTTGGATGAGAAATGGG - Intronic
1104308221 12:127629516-127629538 CTGGTGGGTGGGAGAGAAAATGG + Intergenic
1104730925 12:131104942-131104964 CTGTTGGGTGGATTAGAAAAGGG - Intronic
1104766277 12:131332504-131332526 GTGTATGGTGGCTGAGAACTGGG - Intergenic
1104813127 12:131630093-131630115 GTGTATGGTGGCTGAGAACTGGG + Intergenic
1104822766 12:131687698-131687720 CTGGAGGGTGAGTATGAAATGGG - Intergenic
1105022235 12:132824727-132824749 CGGGTGGGTGGGTGATAAATGGG + Intronic
1106996624 13:35491602-35491624 CTGTAAAGTTGGTGAGAGATGGG - Intronic
1109763410 13:66861118-66861140 CTCTAGTGTAGGTGAGATATGGG + Intronic
1112801292 13:103112622-103112644 CTGAAGGGTGGATGAAGAATAGG - Intergenic
1113080043 13:106509845-106509867 CTGTAGGGTGGGTGAGAAATTGG + Intronic
1114585364 14:23807630-23807652 ATGTAGGGTGGGTGAAAGAAAGG - Intergenic
1114649081 14:24271725-24271747 CTGTAGCGTGCGTGTGAAATGGG + Intronic
1117741581 14:58824369-58824391 TTGTAGAGTGGGTTGGAAATAGG + Intergenic
1117829981 14:59740598-59740620 CTGCAGGGTCGGGGAGAAAAGGG + Intronic
1118434060 14:65753541-65753563 ATGAAGGGTGGGTGAGGAAGGGG - Intergenic
1118682981 14:68262385-68262407 TGGTAGGGTGGGTGAGAAGAGGG - Intronic
1118903126 14:70002985-70003007 CTGTAGGGTGGCTGAGAATTTGG - Intronic
1119730215 14:76946694-76946716 CTCTGGGGTGGGGGAGAATTGGG + Intergenic
1120687534 14:87555216-87555238 GTGTAGAGGGGGTGAGAAAACGG - Intergenic
1120898648 14:89556994-89557016 CTGTGGGGTGGGAAAGAACTTGG + Intronic
1121653230 14:95575419-95575441 CTGTAGGGTGGGGAAGTGATTGG + Intergenic
1122877190 14:104673653-104673675 CTGAGGGGTGGGTCAGAAGTGGG + Intergenic
1124915406 15:33966146-33966168 TTGTAGGGTGGGTGAAAAAGTGG - Intronic
1127749613 15:62021140-62021162 GGGTAGGGTGGGTGAGAAGTAGG + Intronic
1127796592 15:62443691-62443713 CTGTAGGGTGTGTATAAAATGGG + Intronic
1129468324 15:75736753-75736775 CTGTGGGGAGGGTGAGGCATAGG - Intergenic
1129515313 15:76153660-76153682 CTGGAGGCTGGGTGTGAACTTGG + Intronic
1130367784 15:83255758-83255780 CTGGAGGGTGGGGGAGAGTTTGG - Intergenic
1130381308 15:83374584-83374606 CTGTGGGTTGGGAGACAAATGGG - Intergenic
1131317578 15:91353557-91353579 CTGTATGTTGGGTGAGAGAAAGG - Intergenic
1132024170 15:98390825-98390847 CAGTGGGGTGGGTGAGTAGTTGG - Intergenic
1132307881 15:100830799-100830821 CTGTGGGGTGGCCGAGAACTGGG + Intergenic
1134039388 16:11056407-11056429 ATGTAAGGTGGGAAAGAAATAGG + Intronic
1134979287 16:18594171-18594193 CTGGCGGGTGGGTGGGGAATAGG - Intergenic
1135089772 16:19504063-19504085 CTGAAGGGTGAGTGGGAATTGGG - Intronic
1137933717 16:52613202-52613224 GTGGAGGGTGGATGAGAAGTTGG - Intergenic
1138214588 16:55191946-55191968 CTGGAGGGTGGGAGGGAATTTGG + Intergenic
1138647270 16:58434572-58434594 CAGGAGGGTGGGTGATAATTGGG - Intergenic
1139076047 16:63449678-63449700 ATATAGGGGAGGTGAGAAATGGG - Intergenic
1140390436 16:74582046-74582068 CAGTAGAGAGGGTGAGAGATTGG - Intronic
1140691929 16:77492910-77492932 CTGTAGGGAGAGTCACAAATGGG - Intergenic
1140793117 16:78411147-78411169 CTCAAGGGTGGGTGAGACCTAGG - Intronic
1142523791 17:523423-523445 CTATCAGGTAGGTGAGAAATGGG + Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1143124230 17:4631481-4631503 CTCTAGGGAGGGTGGGACATGGG + Exonic
1143444399 17:6998827-6998849 CTGAAGGCAGGGTGAGAAAAAGG + Exonic
1148380536 17:47193654-47193676 GTGTAGGGTGGGTGAGAAGAAGG - Intergenic
1149272406 17:54994658-54994680 ATGTAGGTTGGGAGGGAAATAGG - Intronic
1152047486 17:77947101-77947123 CTGTAGGGTGGATGAGAGCAGGG - Intergenic
1153489376 18:5631150-5631172 GTGCAGGCTGGGTGAGAAAACGG - Intergenic
1153502867 18:5767043-5767065 CCATAGGGTGGGTTAGAAATGGG - Intergenic
1153806419 18:8712120-8712142 CTGCAGGGTGGGTGAGGATTGGG + Intronic
1155793260 18:30000261-30000283 CAGTAGGATGGGAGATAAATAGG - Intergenic
1157385116 18:47253821-47253843 CTGTAGGGTGGGAGGGCACTGGG - Intergenic
1159785137 18:72704641-72704663 CTGTTGGTGGGGTGAGAATTTGG - Intergenic
1159923853 18:74249591-74249613 ATTCAGGATGGGTGAGAAATAGG + Intergenic
1160148871 18:76384597-76384619 CTGTAGGGGGGGTGGGGGATGGG - Intronic
1162021399 19:7870019-7870041 CTGCAGGGTGGGTGAGGCAGGGG + Exonic
1162528583 19:11222249-11222271 CTGCAGAGTGGGGGAAAAATGGG + Intronic
1165279817 19:34786353-34786375 TTCTAGGGTGGGAGAGAGATTGG - Intergenic
926200012 2:10788169-10788191 TTGAAGGCTGGGTGAGAAAGGGG - Intronic
926963156 2:18380780-18380802 ATGTAGGGTGGGTGGGAGGTGGG + Intergenic
928314955 2:30237838-30237860 CTGTGGGGTGGGTGAGTAAATGG + Intronic
928382823 2:30835056-30835078 GTCTAGGGTAGGTGAGAAATGGG - Intergenic
929305834 2:40360561-40360583 CTGTAGGGTTGCTGAGAATGAGG - Intronic
929463711 2:42126027-42126049 CTGTAGGGTGGGGTGGAAATTGG - Intergenic
929468514 2:42168907-42168929 CAATAGGGTGGGGGACAAATAGG - Intergenic
929865926 2:45717224-45717246 CTGTACTGTGGGTGGCAAATGGG - Intronic
929994385 2:46816331-46816353 CTGGAGGGTGGGAGAGAAATGGG + Intergenic
930934380 2:56929725-56929747 CTACAGGGAGGGAGAGAAATGGG + Intergenic
931063229 2:58554795-58554817 CTGTGGTGTGGATAAGAAATTGG - Intergenic
933785492 2:85837968-85837990 GTGTGGGGTGGGGGAGTAATGGG + Intergenic
936560705 2:113537105-113537127 CTTTAGAGGGGGTGAGCAATTGG - Intergenic
940292005 2:152086391-152086413 CAGTTGTGTGGGAGAGAAATAGG - Intronic
940624554 2:156156816-156156838 CTGCAGTGTGCTTGAGAAATTGG - Intergenic
1168845912 20:944615-944637 CTGGAGTGGGGGTGGGAAATGGG + Intergenic
1169006593 20:2212487-2212509 ATGTTGGGTGGGAGAGAAAGAGG + Intergenic
1171290530 20:23980564-23980586 TTGTAGGGTGAGTGAGACGTGGG - Intergenic
1172122076 20:32604332-32604354 CTGTAAGATGGATGAGAAATGGG + Intronic
1172838878 20:37890146-37890168 CTGCAAGGTGTGTGAGAAGTGGG + Intergenic
1174453205 20:50632165-50632187 CTGTGGGGTGGGGGATATATGGG - Intronic
1179579601 21:42332776-42332798 CAGTAGGGTGTGTGTGAAAGTGG + Intergenic
1182585671 22:31343158-31343180 CTGGAGGGGGGAAGAGAAATGGG + Intronic
1182907802 22:33953407-33953429 CTGTAGGGGGAGTGAGATAATGG + Intergenic
1182945051 22:34314221-34314243 CTTTGGGGTGGATGAGAAAGGGG - Intergenic
1183052164 22:35272035-35272057 CTGGAACTTGGGTGAGAAATTGG + Intronic
1184011284 22:41750554-41750576 GTGTGGGGAAGGTGAGAAATGGG + Intronic
1184259236 22:43305251-43305273 CTATTGGAGGGGTGAGAAATGGG + Intronic
1185004721 22:48269001-48269023 CTGAAGGGTGGGTGGGACCTTGG - Intergenic
949412546 3:3781745-3781767 CTGTAGGGTGGAATAGAAAAAGG - Intronic
949423759 3:3893825-3893847 CGGGAAGGTGGGTGACAAATGGG + Intronic
950320125 3:12043801-12043823 CTATATAGTAGGTGAGAAATAGG - Intronic
950334843 3:12185423-12185445 CTTTCAGGTGGGGGAGAAATTGG + Intronic
950352981 3:12375367-12375389 ATCTGGGGTGGGAGAGAAATTGG - Intronic
952817409 3:37457630-37457652 CTGTAGGGTGAGTGAGGACCAGG - Intronic
952924979 3:38314058-38314080 CTGTGGGGTGGGTGGGCTATAGG - Intronic
954451174 3:50572511-50572533 CTGTGGGTTGGGTGAGCCATGGG - Intronic
954758419 3:52856067-52856089 CTGAAGGCTGGGTAAGAATTTGG + Intronic
955452476 3:59084641-59084663 CTGTAAGATGGGTGGGAATTGGG - Intergenic
959189485 3:103092252-103092274 ATGTAAGGTGGAGGAGAAATGGG - Intergenic
964896316 3:161600576-161600598 CTTCAGTGTGGGGGAGAAATGGG + Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
967774517 3:193372815-193372837 CTGGATTGTAGGTGAGAAATTGG - Intronic
969231035 4:5831494-5831516 CTTTAGGGTGAGGGAGAATTAGG - Intronic
969363519 4:6680652-6680674 CTGTAACGTGGCAGAGAAATGGG + Intergenic
971149994 4:24021515-24021537 GGGTAGGGAGGGTGAGAAGTGGG + Intergenic
975233007 4:71956787-71956809 CGGGAGGCTGGGTCAGAAATAGG - Intergenic
977758481 4:100701890-100701912 CCCTTGGGTGGGGGAGAAATGGG + Intronic
980110453 4:128631396-128631418 CTGTGAGGTGGATGTGAAATAGG - Intergenic
984334586 4:178373926-178373948 CTGTATGATGGATTAGAAATGGG + Intergenic
984449455 4:179880910-179880932 CTGAATGGTGTGTCAGAAATGGG + Intergenic
985481142 5:111540-111562 CTTGAGGGTGGGGGAGGAATGGG + Intergenic
987681502 5:21142899-21142921 CTGGAGGGTGGGTGGGATGTTGG + Intergenic
988206046 5:28136420-28136442 CTTTAGAGTTGGTGAAAAATTGG - Intergenic
988994412 5:36700997-36701019 CTGAAGGATGGGTGAAAAAGGGG + Intergenic
990602080 5:57369253-57369275 CTGTAGAGTGGGAGAGAAGGGGG + Intergenic
991126576 5:63076358-63076380 CTGTCTGGTGGCTGAGAAAGTGG - Intergenic
992475957 5:77101858-77101880 CTGCGGGGTGGGGGAGAGATGGG + Intergenic
994888084 5:105592367-105592389 CAGAAGGCTGGGTGAAAAATCGG + Intergenic
996816949 5:127584666-127584688 CTGTAGCCTGGGTGAGAGAGAGG - Intergenic
1000185674 5:158855540-158855562 CTGAAGGGTGGGAGAGAACTAGG - Intronic
1001423114 5:171601756-171601778 CTCCAGGGTGGGTGGGAGATGGG + Intergenic
1001954141 5:175836860-175836882 CTGTAAAGTGGGTGTGACATTGG - Intronic
1002458348 5:179359021-179359043 ATATAGGATGGGTGAGGAATTGG + Intergenic
1002465714 5:179407462-179407484 CTTCAGGGAGGGTGAGAAAGAGG - Intergenic
1003182980 6:3807722-3807744 CTGTGGGGTGGGGGAGACACAGG - Intergenic
1004982528 6:21042250-21042272 GAGTAGGGTGGGTGGGAAATGGG - Intronic
1009350073 6:62663296-62663318 CTGTAAGGTGGGTGTGACTTGGG + Intergenic
1010167360 6:72932210-72932232 CTGTCGGGTGAGTGAGAGCTGGG + Intronic
1014996062 6:128146164-128146186 CTGCAGGATGGGAGAGAAAAAGG + Intronic
1015648290 6:135421043-135421065 CTGAAGAGAGGGAGAGAAATGGG + Intronic
1019446262 7:1073177-1073199 CTGCAGAGTGGGTGAGAAAGAGG - Intronic
1021623580 7:22571661-22571683 TTGGGGGGTGGGTGAGGAATGGG - Intronic
1022040844 7:26579893-26579915 TTGCAGGGAGGCTGAGAAATGGG + Intergenic
1027916759 7:84334625-84334647 CAGCAGGTTGGGGGAGAAATAGG - Intronic
1028293863 7:89102854-89102876 GTATATGGTGGGTGAGAGATAGG + Intronic
1028406008 7:90474721-90474743 CTGTGGTGTGGGTGAGGACTGGG - Intronic
1029491087 7:100870475-100870497 CTGTGGGGTGGGTGGGACGTGGG + Intronic
1031241016 7:119240238-119240260 GTGTAGGCTAGGTGAGAAATGGG + Intergenic
1031532481 7:122892417-122892439 TTAAAGGTTGGGTGAGAAATTGG + Intergenic
1032090352 7:128908687-128908709 CTGGATGGTGGGTGGGCAATTGG - Intronic
1033686323 7:143644391-143644413 CTGTGGGGTGGTTGCTAAATGGG - Intronic
1033689415 7:143722924-143722946 CTGTGGGGTGGTTGCTAAATGGG + Intronic
1033698290 7:143813230-143813252 CTGTGGGGTGGTTGCTAAATGGG + Intergenic
1035176376 7:157054959-157054981 CTGTTGTGTAGGTGGGAAATAGG + Intergenic
1035616034 8:1002625-1002647 CTGTGGGGTGGCTGTGAAATGGG + Intergenic
1036707668 8:11057158-11057180 CTTTAGTTTGGGTGACAAATAGG - Intronic
1037632531 8:20671342-20671364 CTGTAGGATGGGAGAGAATTGGG + Intergenic
1039362872 8:36899013-36899035 CTGCAGAATGGGTGAGAAAGAGG + Intronic
1040732407 8:50464483-50464505 CTGCAGAGAGGGAGAGAAATGGG + Intronic
1040849777 8:51887374-51887396 CTGTATGCTGGATGAGAAATGGG - Intronic
1041243290 8:55867622-55867644 CTATAGGGTTGGTGATAAAATGG - Intergenic
1041388560 8:57329543-57329565 GTGGGGGGTGGGTGGGAAATGGG - Intergenic
1041992033 8:64005000-64005022 CTGAGGGGTGGGAGAGAAAATGG - Intergenic
1043136302 8:76530271-76530293 CTGTTGGGAGGGAAAGAAATGGG - Intergenic
1044352736 8:91185540-91185562 ATGCAGGGTGTGTGAGACATGGG + Intronic
1045421718 8:102022974-102022996 CTGAAGGGAGGGTGTGAGATGGG - Intronic
1045600736 8:103712752-103712774 ATGTAAGGTGGGTTAGACATTGG + Intronic
1045900094 8:107267775-107267797 GGTTAGGGTGGGTGAGACATGGG - Intronic
1046945519 8:119970928-119970950 CTGAAGGTTGGCTGAAAAATCGG + Intronic
1047368455 8:124234573-124234595 CTGTAGGGAGGCTGAGATATGGG - Intergenic
1049095435 8:140545615-140545637 CTGTTGGGAGGGTGAGCACTGGG - Intronic
1049296876 8:141845478-141845500 GGGTGGGGTGGGGGAGAAATGGG - Intergenic
1049678245 8:143903086-143903108 CTGTGGGGTGGTGGAGACATGGG - Intergenic
1049891974 9:78217-78239 CTTTAGAGGGGGTGAGCAATTGG + Intergenic
1050668330 9:7967322-7967344 CTGTAGGGTGGAGGTGAAGTGGG - Intergenic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053733398 9:41079316-41079338 CTTTAGAGGGGGTGAGCAATTGG + Intergenic
1054695026 9:68352249-68352271 CTTTAGAGGGGGTGAGCAATTGG - Intronic
1058040460 9:100296319-100296341 GTTTAGAGTGGGTGAGGAATGGG - Intronic
1060493395 9:124100961-124100983 CTGTGAGGTGGGGGAGAAACTGG + Intergenic
1061237121 9:129349716-129349738 CTCTAGGGTGGATGAGGAAACGG - Intergenic
1186659907 X:11659345-11659367 CTGTAGAGAGTGGGAGAAATTGG - Intronic
1186663176 X:11690275-11690297 CTGGAGGATGGGGGATAAATGGG + Intergenic
1186889362 X:13945156-13945178 CAGTAAGCTGGGTGAGAAATGGG + Intergenic
1187359342 X:18610214-18610236 CTGGGGGGTGGGGGAGAAAGTGG - Intronic
1187720764 X:22148633-22148655 CTGGAGGGAGGGGGAGAGATAGG - Intronic
1189616027 X:42785229-42785251 CAGGAGGGTGGGAGAAAAATTGG - Intergenic
1190409193 X:50117749-50117771 CTGTAGGGTTGGGGAGATAAAGG + Intergenic
1194117357 X:89919668-89919690 CTGGAAAGTAGGTGAGAAATTGG - Intergenic
1195849539 X:109268388-109268410 CTGTGGGATGGTTCAGAAATGGG - Intergenic
1197169160 X:123412013-123412035 CTGTAGGCTGGGAGAGAGAGTGG - Intronic
1197755005 X:129987214-129987236 AAGTAGGGTGGGGGAGAAACTGG + Intronic
1198058232 X:133016750-133016772 CTATATGGTGGTTGAGAAAGAGG + Intergenic
1198263887 X:134991402-134991424 CTCTAGGGTGGGTGAGCAGGTGG - Exonic
1200470147 Y:3576811-3576833 CTGGAAAGTAGGTGAGAAATTGG - Intergenic