ID: 1113080639

View in Genome Browser
Species Human (GRCh38)
Location 13:106516259-106516281
Sequence GGGTCAGAAACTGCATCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113080639_1113080644 7 Left 1113080639 13:106516259-106516281 CCTGCAGATGCAGTTTCTGACCC 0: 1
1: 0
2: 1
3: 8
4: 179
Right 1113080644 13:106516289-106516311 CTGGAAAAAGTTCTAAGTATTGG 0: 1
1: 0
2: 2
3: 18
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113080639 Original CRISPR GGGTCAGAAACTGCATCTGC AGG (reversed) Intronic
901208595 1:7511661-7511683 TGGTGAGAAACTGCCTCTGGTGG - Intronic
905771366 1:40640101-40640123 GGGTCTGAAGCTGAATCAGCTGG + Intronic
915566295 1:156715121-156715143 TTGTCAGAAACTGAATTTGCAGG - Intergenic
920778923 1:208969173-208969195 GGCTCAGAAGCAGCATCTCCAGG + Intergenic
922491490 1:226020634-226020656 GGATCAGAACCTGCATGTTCAGG - Intergenic
922975160 1:229778090-229778112 GGGTCAGTGGATGCATCTGCAGG - Intergenic
923113867 1:230915989-230916011 CAGTCAGAAAATGTATCTGCTGG + Intronic
923815492 1:237373297-237373319 GAGTCAGAATCAGAATCTGCAGG + Intronic
924168218 1:241307735-241307757 GTGTCAGATACTGCAGGTGCTGG - Intronic
1063283662 10:4660199-4660221 CTGACAGAAACTGCATCTCCAGG + Intergenic
1063782680 10:9344388-9344410 GAGTCAGGAACCGCACCTGCAGG + Intergenic
1068300820 10:55136250-55136272 GGGTTAGATACTACATTTGCTGG + Intronic
1071086532 10:81874131-81874153 GGGTCAGAGACTGACGCTGCTGG - Intergenic
1071328185 10:84536970-84536992 GGGTCAGAAACTGGATGGGGAGG - Intergenic
1073497330 10:103905119-103905141 GAGTTATAAACTGCATCTGCTGG - Exonic
1073592780 10:104772252-104772274 GGGCAAGGATCTGCATCTGCAGG + Intronic
1075632017 10:124006212-124006234 GGGGCAGAAGCTGCATCGGCCGG - Intergenic
1077087341 11:760526-760548 AGGACAGAATCTGAATCTGCAGG - Intronic
1079130336 11:17743609-17743631 GGATCAGAAGCTGCTTGTGCAGG + Intronic
1080903397 11:36516620-36516642 AGTTCAAAAACTGAATCTGCCGG - Intronic
1082788759 11:57332765-57332787 GAGTCAGACACTGCAGCTCCCGG + Exonic
1084558267 11:69888052-69888074 GGCTCAGAGCCTGCATCGGCAGG - Intergenic
1085108174 11:73863910-73863932 GGGACAGAGACAGCATGTGCTGG + Intronic
1085778965 11:79391323-79391345 GGGTGAGTAAATGCATCTGCAGG - Intronic
1086664054 11:89457531-89457553 GGGCCAGAGACTGCAGCTGAGGG + Intronic
1086689966 11:89778781-89778803 GGAGGAGCAACTGCATCTGCAGG + Intergenic
1086715888 11:90061174-90061196 GGAGGAGCAACTGCATCTGCAGG - Intergenic
1086744728 11:90410790-90410812 TCATCAGAAACTGAATCTGCTGG - Intergenic
1088932553 11:114366558-114366580 GGGTCAGTGACTCCATCTCCAGG - Intergenic
1091252504 11:134155434-134155456 CGGACAGAGACTGCATCAGCAGG + Intronic
1095673714 12:44891449-44891471 GGCTCAGAAACTACCACTGCTGG + Intronic
1100764070 12:97844007-97844029 GGGTGAGAAAATGAATCTGAGGG + Intergenic
1101974801 12:109347779-109347801 GAGGCAGAAACTGCATCTTATGG - Intergenic
1102198920 12:111044117-111044139 GGGTCAACACCTGCACCTGCCGG - Intronic
1102824702 12:115938552-115938574 GGGTCAGAAACTGTACATTCTGG + Intergenic
1102974927 12:117199913-117199935 TGGTCAGAAAGTGTCTCTGCAGG - Intergenic
1110305429 13:73981799-73981821 TGGCCAGACACTGAATCTGCTGG + Intronic
1111235701 13:85405374-85405396 TGGGCAGAAACTGCCCCTGCCGG + Intergenic
1113080639 13:106516259-106516281 GGGTCAGAAACTGCATCTGCAGG - Intronic
1113796643 13:113062004-113062026 GGGGCAGTAACTGCAGGTGCAGG + Intronic
1113863731 13:113507996-113508018 GCATCAGAAACCCCATCTGCAGG - Intronic
1113898972 13:113785415-113785437 GAGTCAGAAACCGCAGCTGGGGG - Intronic
1118318835 14:64741763-64741785 TGGTAAGAAACTCCATCTCCAGG + Exonic
1119172363 14:72544954-72544976 GGGGCAGGAGCTGCTTCTGCCGG - Intronic
1119784576 14:77302814-77302836 AGGTCAGAAACTCCATCCCCGGG - Exonic
1120355029 14:83421600-83421622 GGAGCAGAAACAGCCTCTGCTGG + Intergenic
1121010634 14:90518132-90518154 GGGACAGAGACAGCTTCTGCCGG + Intergenic
1122931430 14:104934381-104934403 GGTTCAAATCCTGCATCTGCAGG - Exonic
1123024557 14:105418657-105418679 GGGTAGGAAACAGCATGTGCTGG - Intronic
1125723825 15:41857963-41857985 GGGTCAGGACCTGCCTTTGCAGG + Intronic
1125933606 15:43616737-43616759 GGGTCAGAATCTTCAGCTGGAGG - Intronic
1125946704 15:43716199-43716221 GGGTCAGAATCTTCAGCTGGAGG - Intergenic
1129367514 15:75065600-75065622 GGGCCAGGAAGTGCAGCTGCAGG + Intronic
1131390853 15:92047841-92047863 GGGACTGAAACTGCAGCTGGTGG - Intronic
1132981224 16:2739559-2739581 GTGTCAGAAGTTGCCTCTGCAGG + Intergenic
1135584455 16:23657881-23657903 GGGTTAAAAAGTGCATATGCTGG - Intronic
1135953079 16:26933440-26933462 AGGCCAGAAACTGCATCATCTGG - Intergenic
1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG + Intergenic
1137852405 16:51759311-51759333 GGGTGGTAAACTGCATCTACAGG - Intergenic
1140258492 16:73357265-73357287 GGGGCATAAAATGCATCAGCAGG + Intergenic
1141029113 16:80572395-80572417 AAGTCACAACCTGCATCTGCAGG + Intergenic
1141814800 16:86402309-86402331 GGTTCAGAAGCTGCTTCTGTTGG + Intergenic
1144081193 17:11765834-11765856 AGGTCAGAGACTGCATTTGACGG - Intronic
1144711477 17:17404254-17404276 GGGACAGAGCCTGCATCTGGGGG - Intergenic
1144955997 17:19019202-19019224 GAGTCAGGAGCTGCACCTGCAGG + Intronic
1147004144 17:37388181-37388203 GGGTCAGAAGCTCAATCTGGCGG - Intronic
1148346809 17:46908703-46908725 GGGTCAGCACCTGCACCTTCCGG + Intergenic
1152586296 17:81190951-81190973 GGGCGAGAATCTGCGTCTGCAGG - Exonic
1153263204 18:3244146-3244168 GGGACAGATACTGCATCTAGTGG - Intergenic
1153322903 18:3791001-3791023 GAGGCAGAAACCACATCTGCGGG - Intronic
1153855438 18:9140359-9140381 GGATCAGAAAATGTATCTACAGG - Intronic
1155493454 18:26421501-26421523 GCATCAGCAACTGCATCTGGTGG + Intergenic
1155728128 18:29115693-29115715 AGATCAGAAACTGAATCTCCAGG - Intergenic
1157678134 18:49582730-49582752 GGGTCAGCAGCTGGATCAGCTGG + Intronic
1159715377 18:71815161-71815183 GGTTCAGAAAGTACATGTGCAGG - Intergenic
1160316168 18:77849607-77849629 GGGACAGAAACTGCATAGGCTGG + Intergenic
1160476151 18:79190114-79190136 GGGTTTGATACTGCATCTTCAGG + Intronic
1160535775 18:79590550-79590572 GGCTCAGAAACAGCAGCTGTGGG - Intergenic
1161704431 19:5812513-5812535 GGTTCCGATACTGCGTCTGCGGG - Intergenic
1162555722 19:11384280-11384302 GGGTCAGCAGCTGCCTCCGCCGG + Exonic
1164884745 19:31769119-31769141 GGGTCTGAAACAGCAGCTGTGGG - Intergenic
1166183618 19:41125166-41125188 GGGTCTGGAACTTCATCTGGAGG + Intronic
1166574014 19:43819894-43819916 GGGTCAGGAACTGGATCAGTGGG - Intronic
925526284 2:4805712-4805734 GGGTCAGAAACTCCAGGGGCAGG + Intergenic
927162483 2:20280252-20280274 GTCTCAGAAACTGCATTGGCTGG - Intronic
927680052 2:25133053-25133075 GGGTCAGAAAATGCAGCTGGGGG - Intronic
928198380 2:29230936-29230958 GGGTCAGAAACCTCCTCAGCTGG - Intronic
929831117 2:45347292-45347314 TCGTCAGATACTGAATCTGCTGG - Intergenic
931088746 2:58863601-58863623 GTGTCAGGAAGTGCCTCTGCAGG + Intergenic
932815003 2:74854449-74854471 GGGACAGGTACTGCATCTGGGGG + Exonic
934788443 2:97034529-97034551 GGAGAAGCAACTGCATCTGCAGG + Intergenic
939706080 2:145455488-145455510 GTGACAGAAACTGAATCTGAAGG + Intergenic
940902739 2:159140989-159141011 TGCTCAGAATCTCCATCTGCTGG - Intronic
941059770 2:160833353-160833375 GGGTCAGTAACAACATCTTCAGG - Intergenic
941314349 2:163973859-163973881 GGATGATACACTGCATCTGCAGG + Intergenic
942309814 2:174645579-174645601 GGGTCAGAAACAGCATTTGCTGG - Intronic
942590553 2:177541480-177541502 GATTCACAAACTGCATGTGCTGG + Exonic
943062208 2:183050851-183050873 GAATCAGGATCTGCATCTGCAGG + Intergenic
943111481 2:183611401-183611423 GGGTGAGAAAGTGCATCTAGGGG + Intergenic
943404559 2:187463606-187463628 AGTTCAGAAACTGGACCTGCAGG + Intergenic
944308941 2:198210716-198210738 TCATCAGAAACTGAATCTGCTGG - Intronic
947058477 2:226134952-226134974 GGGTTAGACACTTCATCAGCAGG + Intergenic
947454065 2:230237110-230237132 GGGTCAGAACCTGCAGGAGCAGG + Exonic
948583750 2:239005444-239005466 AGGGCAGAACCTGCCTCTGCTGG + Intergenic
948866340 2:240776721-240776743 GGGTCAGAGGCCTCATCTGCCGG - Intronic
1169084065 20:2816171-2816193 GCATGAGAAACTACATCTGCGGG + Intergenic
1169405629 20:5318671-5318693 GTGCCTGGAACTGCATCTGCAGG + Intergenic
1170442643 20:16394888-16394910 GCTTCAGAAACAGAATCTGCTGG - Intronic
1172805023 20:37605643-37605665 GGGTCAGAAACCACTGCTGCTGG + Intergenic
1173020939 20:39267876-39267898 GGGTCAGAGACTGCAAGGGCAGG + Intergenic
1173426029 20:42944232-42944254 GGGGCGGAAAGTGCTTCTGCTGG + Intronic
1174733011 20:52936746-52936768 GGTTCAGAAAAGGGATCTGCGGG - Intergenic
1175295518 20:57906289-57906311 TGGTTAGGAACTGCATCTCCTGG - Intergenic
1176001416 20:62833145-62833167 GGGTCAAAATCTGCAGCTCCCGG + Intronic
1177168189 21:17626689-17626711 GAGTCAGCAAGTGCAGCTGCTGG + Intergenic
1177338476 21:19764191-19764213 GTGTCAGACACTGCATTTGTGGG - Intergenic
1177350569 21:19935421-19935443 GAGTCAAAAAGTGCCTCTGCAGG + Intergenic
1177781266 21:25624711-25624733 TAGCCAGACACTGCATCTGCTGG + Intergenic
1178469441 21:32878958-32878980 AGGTCAGAAATTCCATCTGTGGG + Intergenic
1179074175 21:38103018-38103040 GAGTCTGAAACTGATTCTGCTGG - Intronic
1180710651 22:17837184-17837206 GGCTCAGGAGCTGCCTCTGCAGG + Intronic
1182395561 22:30033532-30033554 GGGACATAAACTGCATCCCCTGG + Intergenic
1182453646 22:30435793-30435815 GGGGCAGAAAGTGCACCAGCAGG - Intergenic
1184138109 22:42561460-42561482 GGGTCAGAAACTCCAGCACCTGG + Intronic
1184779156 22:46637698-46637720 TGTCCAGAAACTGCAGCTGCTGG + Intronic
950188088 3:10957693-10957715 GGGTTTGGAACTGCATCTGGTGG - Intergenic
953429926 3:42830733-42830755 GCATCAGAAACTGAATCTGCTGG + Intronic
954380966 3:50218818-50218840 GGTTTGGAAACAGCATCTGCTGG - Exonic
956308754 3:67855826-67855848 TGGTCCCAAACTGCATCAGCTGG + Intergenic
956772574 3:72538884-72538906 GTGTCAGCCACTGCATCTGGTGG + Intergenic
962867764 3:139461793-139461815 GGGACAGCACCTGCACCTGCTGG - Intronic
965276482 3:166689757-166689779 GGGTCAGAGAATACATGTGCAGG + Intergenic
972375142 4:38462815-38462837 GGGTCAGAATCTCCCTGTGCAGG - Intergenic
972991825 4:44829926-44829948 GAGTCAGAATGTGCATCTGCTGG + Intergenic
973198695 4:47475852-47475874 GTATCTGAAACTGCTTCTGCTGG - Intergenic
978712343 4:111799685-111799707 AGGTCTGACTCTGCATCTGCGGG - Intergenic
979973095 4:127161921-127161943 TGGTCAGTAAGTGCTTCTGCAGG - Intergenic
980288495 4:130812835-130812857 GGGTGAGTAACTGCCTCTGATGG - Intergenic
980483052 4:133414371-133414393 CCGTCAGATACTGAATCTGCTGG + Intergenic
987147603 5:15007599-15007621 GGGTCTGAAACAGTATCTACTGG - Intergenic
988699751 5:33661688-33661710 TGTTAATAAACTGCATCTGCTGG - Intronic
990355349 5:54961197-54961219 GGCTCAGAAACTGAGTCTGTAGG + Intergenic
991403528 5:66278733-66278755 TAGTCAGACACTGAATCTGCTGG - Intergenic
994869634 5:105331017-105331039 GGGTAAGAAACTGTATGTTCAGG - Intergenic
998271825 5:140713398-140713420 GGCTCTGTAACTGGATCTGCTGG + Intergenic
998272692 5:140721112-140721134 GGCTCTGTAACTGGATCTGCTGG + Intergenic
998273440 5:140728187-140728209 GGCTCTGTAACTGGATCTGCTGG + Intergenic
1002563705 5:180098750-180098772 GGGCCAGACACTGAATCAGCCGG + Intergenic
1005787341 6:29258768-29258790 CAGTCAGAAACTGCAGCAGCTGG - Intergenic
1007421682 6:41723573-41723595 GGGTGAGAAACAGCAGCCGCCGG - Intronic
1011728192 6:90232218-90232240 GGGTCAAAACCTACCTCTGCAGG + Intronic
1017712015 6:157178570-157178592 ATGTAGGAAACTGCATCTGCAGG - Intronic
1017813784 6:158002527-158002549 GGATCAGAACCTGCAGCCGCAGG + Intronic
1020234937 7:6348305-6348327 GGGTCCGAGACTGCATGGGCTGG - Intronic
1027263863 7:76483221-76483243 GGGGCAGGAGCCGCATCTGCAGG - Intronic
1027315234 7:76981334-76981356 GGGGCAGGAGCCGCATCTGCAGG - Intergenic
1032690673 7:134283367-134283389 GGGTCAGGCACTGGAGCTGCAGG + Intergenic
1035295485 7:157864859-157864881 GGGGCAGAAACTGCAGGTTCAGG - Intronic
1035675973 8:1455734-1455756 GGGTCAGGAAGTGCCTCTGGAGG - Intergenic
1036827146 8:11986387-11986409 GGTGCAGAAACTGCAAGTGCAGG + Intergenic
1037371404 8:18183503-18183525 GGGTAAGGAACTTCTTCTGCCGG - Intronic
1037924282 8:22832414-22832436 TTGTCAGACACTGAATCTGCTGG + Intronic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1041258536 8:56000373-56000395 TGGTCAGAATCTGGCTCTGCAGG - Intronic
1042935720 8:74056042-74056064 GGAACAAAAACTGCATCTGTTGG + Intergenic
1045439827 8:102198253-102198275 GGGTCAGACGCTGCAGCAGCTGG - Intergenic
1045921212 8:107531679-107531701 GGATGAAAAACTGCATCTGAGGG - Intergenic
1046089493 8:109483043-109483065 CTCTCAGAAACTGCATTTGCAGG + Exonic
1047095264 8:121618336-121618358 GGGACATACACTGTATCTGCAGG - Intronic
1048263209 8:132963062-132963084 GGGTCAGTACCTGCTTCTGTTGG - Exonic
1049179115 8:141212073-141212095 GGGTCGGCCACAGCATCTGCAGG + Intronic
1049192653 8:141297130-141297152 GGGTCAGAAACTGCTTCCTCTGG + Intronic
1050747769 9:8897401-8897423 GGATCAGAAAGTGCTTCTGAGGG + Intronic
1051817239 9:21122116-21122138 GTGCCTGAAACTGCCTCTGCAGG - Intergenic
1052250718 9:26394178-26394200 GGGTCAGCCACTGGCTCTGCTGG + Intergenic
1053459094 9:38254692-38254714 AGGTCAGATACTGCATGTCCTGG + Intergenic
1058739127 9:107924799-107924821 GGGACTGACACTGCATCTCCTGG - Intergenic
1059031493 9:110702423-110702445 GGGCCAGAAATTCCATCTTCAGG + Intronic
1059040394 9:110808452-110808474 AGGTCAGAAACTACATCAACAGG + Intergenic
1185705575 X:2263971-2263993 ATGTCAGGCACTGCATCTGCAGG - Intronic
1186433105 X:9521346-9521368 GGGTCAGTTCCTGCATCTACCGG - Intronic
1186891739 X:13965753-13965775 GGGACAGAAGCTGCATCCCCCGG - Intergenic
1188113673 X:26219609-26219631 GAGTCAGCAGCTGCAGCTGCTGG + Intergenic
1194800256 X:98264226-98264248 GGTGCAGCAACTGCAGCTGCAGG - Intergenic
1195711510 X:107776638-107776660 GGGACAGAGACTGCCTCTGAGGG - Intronic
1196028759 X:111072697-111072719 GTGTCAGAAACTGAATTTGTAGG + Intronic
1197602123 X:128543291-128543313 GGGACAGAACCTGTATCTCCCGG - Intergenic
1197998451 X:132406251-132406273 GGAGCATAAGCTGCATCTGCTGG + Exonic
1198506653 X:137308043-137308065 GAATCAGACACTGCATCTCCTGG - Intergenic