ID: 1113082326

View in Genome Browser
Species Human (GRCh38)
Location 13:106533217-106533239
Sequence TGCCCGCCCGGTGCCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113082326_1113082337 30 Left 1113082326 13:106533217-106533239 CCTCTGGAGGCACCGGGCGGGCA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1113082337 13:106533270-106533292 GCCCGCCCGCCCGCCTCTCCCGG 0: 1
1: 0
2: 10
3: 70
4: 485
1113082326_1113082330 -10 Left 1113082326 13:106533217-106533239 CCTCTGGAGGCACCGGGCGGGCA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1113082330 13:106533230-106533252 CGGGCGGGCAGCGGCGCCGCGGG 0: 1
1: 0
2: 7
3: 63
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113082326 Original CRISPR TGCCCGCCCGGTGCCTCCAG AGG (reversed) Intronic
900163470 1:1235505-1235527 TGCCGGCCCTGTGCCTCCTGGGG - Intergenic
907323864 1:53622740-53622762 TTCTCCCCCGGAGCCTCCAGAGG + Intronic
915131454 1:153698099-153698121 TCCCCTCCCGGTGCCCGCAGTGG - Intergenic
915339639 1:155169603-155169625 TGCCAGCCTGGTGCCTCCTAGGG + Intronic
915740205 1:158113477-158113499 TGCCCGCTCGGTGGCTGCCGCGG + Intergenic
917736898 1:177929728-177929750 TGCTAGCCCGATGCCTCCACCGG - Exonic
920504499 1:206506933-206506955 TGACCGCCGGATGCCTCCAAGGG - Intergenic
923543751 1:234908944-234908966 TGCAGGCCCCTTGCCTCCAGAGG + Intergenic
1067135914 10:43606896-43606918 CGCCCGCCCGTTCCCTCCACAGG - Intronic
1070192035 10:74119912-74119934 TGCTCTCCCGGTTCTTCCAGTGG + Exonic
1070820671 10:79352263-79352285 TCCCAGGCAGGTGCCTCCAGGGG + Intronic
1073208259 10:101779992-101780014 CGCCCGCCCGGAGCCTCTAGAGG + Intronic
1075030502 10:119021493-119021515 TCCCCGCCAAGAGCCTCCAGAGG + Intergenic
1075608499 10:123833443-123833465 AGCACCCCCAGTGCCTCCAGAGG - Intronic
1076265258 10:129104417-129104439 TGGCAGCCAGGTGCCTGCAGGGG - Intergenic
1076794840 10:132793457-132793479 TGAGGGCCAGGTGCCTCCAGAGG - Intergenic
1077085292 11:747159-747181 AGCCCTCCCGGTGCGTCCCGCGG + Intergenic
1077096556 11:801534-801556 TGCCTGCCTGGTGCCACCGGAGG - Exonic
1077194609 11:1272838-1272860 AGCGGGCCTGGTGCCTCCAGTGG + Intergenic
1080643904 11:34174488-34174510 GGCCCGCTCTGTGCCACCAGGGG + Intronic
1083886465 11:65575864-65575886 TGCCCGCTCGGTGCGCGCAGAGG - Intergenic
1085728403 11:78975267-78975289 TGCCCACGCGCTGCCTCCAGAGG + Intronic
1090804428 11:130194127-130194149 TGCCCGCCCTCTGCCCCCACAGG + Exonic
1091229170 11:133976806-133976828 TGCCCATTCCGTGCCTCCAGAGG + Intergenic
1091582581 12:1798224-1798246 TTCCCTCCCGGAGCCTCCTGAGG + Intronic
1091830981 12:3551128-3551150 TGGCCACCTGCTGCCTCCAGAGG + Intronic
1104571503 12:129929925-129929947 TCCACGCCAGGTGCCTTCAGGGG - Intergenic
1105013688 12:132773179-132773201 TGCCAGCCCTGTGCCCCCGGGGG - Exonic
1105071148 12:133235366-133235388 TGTCCGCCCGGTGCCCTGAGGGG + Exonic
1113082326 13:106533217-106533239 TGCCCGCCCGGTGCCTCCAGAGG - Intronic
1114266314 14:21074576-21074598 TCCACGCCCGGTGTCTCCGGTGG - Exonic
1115504505 14:34080360-34080382 TGCCTGCCCTGTGCATCCAATGG + Intronic
1119325768 14:73759027-73759049 AGCCCGCGCGGTGCCTCGCGGGG - Intronic
1120789164 14:88563274-88563296 AGCCCGCCAGGAGCGTCCAGCGG - Intronic
1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG + Intronic
1122783931 14:104155366-104155388 TGGCCGCCTGGTGCCTGCTGTGG + Intronic
1122858381 14:104571062-104571084 TGCACGTCCGGGGCCCCCAGAGG - Intronic
1123110956 14:105866655-105866677 TGCCCGCACGGTGCCTGAGGGGG - Intergenic
1124646823 15:31442815-31442837 TCCCCACCCTGTGCCTGCAGGGG + Intergenic
1128875947 15:71201502-71201524 TGCCCACGCAGTGCCTCCAAGGG + Intronic
1132372913 15:101310331-101310353 TGCCCGCCTGCTGCCTCCTGAGG + Intronic
1137407120 16:48197913-48197935 TGCCTGCCTGGGTCCTCCAGAGG - Intronic
1137665218 16:50245902-50245924 TGCCCGGCCGCTCCCTCCCGCGG + Intergenic
1140279689 16:73543460-73543482 GGCCCTGCCGGTGCCTCCAAAGG - Intergenic
1140862365 16:79029161-79029183 TCCCAGCCTGGGGCCTCCAGAGG - Intronic
1141703976 16:85654781-85654803 TCCCCGCCTGCAGCCTCCAGCGG + Exonic
1142266873 16:89068016-89068038 TGCCTGCCCGGGGGCTCCTGAGG + Intergenic
1143150766 17:4806857-4806879 TGCCCGGCCGCTGCCTCCCGGGG - Intergenic
1143582041 17:7833329-7833351 TGCTCTCCCGGAGGCTCCAGGGG + Intronic
1144742462 17:17591637-17591659 GGCCCGCGTGGTGCCTCCTGAGG - Exonic
1148782452 17:50129624-50129646 AGCCCGCCCGGAGCCCCCCGCGG - Exonic
1152420718 17:80191553-80191575 TGTCCTCCCAGTGCCTCCATGGG - Intronic
1152561358 17:81080368-81080390 TGCCCGCCCTGAGCTTCGAGCGG - Intronic
1152751749 17:82065541-82065563 TGCCCGCCGCGTGGCTCCGGAGG - Exonic
1152803746 17:82344783-82344805 TGTCGGCTCCGTGCCTCCAGCGG + Intergenic
1157721610 18:49929479-49929501 TGCCCGCCAGCTGCCTCCTGGGG - Intronic
1160769429 19:823685-823707 TGGCCCCCCGGTTCCTGCAGGGG + Intergenic
1161495744 19:4584760-4584782 TGCCCGTTCGGAGCCCCCAGGGG - Intergenic
1162973644 19:14195915-14195937 TGGCAGCCCAGTCCCTCCAGGGG + Intronic
1164834511 19:31349111-31349133 CGCTCGCCCCGCGCCTCCAGCGG - Intronic
1165099994 19:33433401-33433423 TGCCCACTCTGTACCTCCAGGGG + Intronic
1165742295 19:38211379-38211401 TGCCCGCCCCGTGCCTGCCGTGG - Intronic
1165797744 19:38528590-38528612 TACATGCCCGGTGCCTGCAGGGG - Exonic
1166359701 19:42247993-42248015 TGCCTGCCCTGCCCCTCCAGGGG - Exonic
1166869583 19:45863329-45863351 TTTCCGCCCGGTGCCTCCGAAGG - Intergenic
1167366243 19:49056340-49056362 TGCCCGGCAGGGGCTTCCAGTGG + Exonic
1168324158 19:55529777-55529799 CGCCCTCCCGCTGCCTCCAGGGG + Exonic
925349099 2:3188719-3188741 TGCCCGCCCTGGGCCTCCCCTGG - Intergenic
927213217 2:20651161-20651183 TGCGCGGCCGCTGCCACCAGGGG - Intergenic
928056320 2:28058953-28058975 AGCCCGCCCTGTGCCTTCTGTGG + Intronic
930015909 2:46970440-46970462 TGCCAGCCCCAAGCCTCCAGAGG - Intronic
934765893 2:96879814-96879836 TGCCTGCCGGGTCCCTGCAGCGG + Intronic
938548828 2:132361137-132361159 TGCCTGCCCTGTGCCTGCAACGG - Intergenic
940214437 2:151289676-151289698 TCCCCTCCCAGTGCCTCCCGGGG - Exonic
941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG + Intergenic
947952659 2:234161440-234161462 TCCCCACCCTCTGCCTCCAGGGG - Intergenic
948854771 2:240724974-240724996 TGCCCACCTGGGGCCTCCTGTGG - Intronic
1168979101 20:1989904-1989926 TGCACTCCAGGTGCCTCCCGTGG + Intronic
1172352727 20:34255962-34255984 GGCCCACCCGCAGCCTCCAGAGG + Intronic
1173810087 20:45950188-45950210 TGCCCACCCTGTGGCCCCAGGGG + Intronic
1175972848 20:62695646-62695668 TGCCCATCCGGAGCCTCCTGGGG - Intergenic
1176057000 20:63154364-63154386 TGCCCTCCCGCTGCCTCCCAGGG + Intergenic
1179919360 21:44499268-44499290 TGCCCACCCGCTGCCTAGAGAGG + Exonic
1182847925 22:33446748-33446770 TGCCCGCCTGTTCCCTTCAGTGG - Intronic
1183082359 22:35464618-35464640 TCACAGCCCTGTGCCTCCAGGGG - Intergenic
1183102479 22:35592486-35592508 AGTCAGCCCAGTGCCTCCAGAGG - Intergenic
1185276744 22:49953188-49953210 TGCCAGGCAGGTGCCTCCAAAGG - Intergenic
1185341212 22:50291933-50291955 GGCCCACCCCGTGCCTCCAGAGG + Intronic
950153483 3:10706456-10706478 AGCCCACCCAGTGGCTCCAGTGG + Intronic
954219498 3:49144310-49144332 TGCCAGCCCTGTGCCTGCAATGG - Intergenic
954411306 3:50372388-50372410 TGCCGGCCCGCTGCTTCCAGAGG - Intronic
958462559 3:94418149-94418171 TGCCCGCCCCGTGGCTCCTAGGG + Intergenic
961488823 3:127236799-127236821 TGCCCGCCTCCTCCCTCCAGTGG + Intergenic
964819664 3:160755881-160755903 CGCCCGCGCGGTCCCTCCGGGGG - Intronic
968742621 4:2339202-2339224 TGGCCGCCGTGGGCCTCCAGGGG - Intronic
969156928 4:5219245-5219267 TGGCCACCCAGGGCCTCCAGAGG - Intronic
969530266 4:7726605-7726627 TGCCCGCCCCATGCCTCCCTGGG + Intronic
971230955 4:24799986-24800008 GGCCGGCGCGGTACCTCCAGAGG - Exonic
985478537 5:92703-92725 TGCCCTCTCGGTGCCTGAAGGGG + Intergenic
985649374 5:1100209-1100231 TGCCGTCCCGGTGCCGCCCGAGG - Intronic
985702034 5:1379251-1379273 TGTCCGCCAGGTGCCCACAGGGG - Intergenic
985995552 5:3595387-3595409 CGCGCGGCCGGGGCCTCCAGGGG - Intergenic
991987800 5:72308087-72308109 TGCGCCCGCGGTGCGTCCAGAGG - Intronic
993386508 5:87268400-87268422 TGCCCGCCCGGGAGCCCCAGGGG - Exonic
998503380 5:142652805-142652827 TGCCCGCCCGGGGCCTGGCGTGG - Intronic
1000210919 5:159105318-159105340 AGCGCGCACGGTGCCTCCCGAGG + Intergenic
1000340363 5:160272365-160272387 TGCCTGCCAGGTACCTGCAGTGG - Intronic
1002443513 5:179276192-179276214 TGCCTGCTCGGTGCCTCCCTTGG - Intronic
1003921425 6:10837415-10837437 GTCCTGCCCGGTGCCTGCAGTGG + Intronic
1005658364 6:27967098-27967120 TCCAGGCCCGGTGCCTGCAGGGG - Intergenic
1009402627 6:63274959-63274981 TGCCAGTCCTGTGCCACCAGCGG + Intergenic
1013225545 6:108117720-108117742 ACCCAGCCCGGTGCCTCGAGAGG + Intronic
1016614411 6:146029445-146029467 TGCGCGCCGGGAGCCTGCAGCGG + Exonic
1017772817 6:157656208-157656230 TCACAGCCCGGTGCCTTCAGCGG - Intronic
1019279470 7:192750-192772 CGCCCGCCCGGCGCCTGGAGAGG + Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019436677 7:1025808-1025830 TGCCTCCCCTGGGCCTCCAGAGG + Intronic
1024948197 7:54833167-54833189 CGCCCGCCCTGTGCAGCCAGGGG + Intergenic
1027199573 7:76054858-76054880 TGGCTGCCCGATGCCTCCAGAGG - Exonic
1027215037 7:76178280-76178302 TTCCCGCCTGCTGCCTGCAGAGG + Intergenic
1033033209 7:137846747-137846769 AGCCCGCCCGGCCCCTGCAGCGG - Exonic
1034272944 7:149812136-149812158 TGCCCGCCTGGACCCTCCTGGGG + Intergenic
1034528058 7:151678551-151678573 TGCCAGCCCGGGGCTTCCAGAGG - Intronic
1036943793 8:13075335-13075357 GGCCCTCCCGGGGCCTCAAGTGG - Intergenic
1037458384 8:19084948-19084970 TGCCCGGCCATTTCCTCCAGGGG + Intergenic
1038530825 8:28317001-28317023 TGCCTTCCCTGTGCTTCCAGAGG - Intronic
1039183890 8:34895304-34895326 TGCCCGGCCGCTGCCTCTGGGGG + Intergenic
1040915723 8:52565160-52565182 TGCGCCCCCGGGGCCTCCCGTGG + Exonic
1045111335 8:98941104-98941126 AGCTCGGCCGGTGCCTCCAGGGG + Intronic
1047367337 8:124223466-124223488 TGTCCTCCTGGTGGCTCCAGAGG - Intergenic
1049720381 8:144112826-144112848 TGCCCTCCCAGCGCCTCCACGGG - Intronic
1050356952 9:4792780-4792802 TGCCCGCGCCGCGCCTCCATTGG - Intergenic
1055610673 9:78020915-78020937 TGCCTGCCTGGCACCTCCAGTGG + Intronic
1057294648 9:93828058-93828080 CGCCCGCCCTGGGCCGCCAGCGG - Intergenic
1061119732 9:128635449-128635471 TGCTCACTCGGTGCCTGCAGAGG + Intronic
1061601723 9:131674821-131674843 TGCCCTCCCCGCGCCTCCACAGG - Intronic
1062064325 9:134518077-134518099 TGCTCGCGGGGTGCCTCCCGAGG + Intergenic
1062249177 9:135585798-135585820 TCCCTGCCCGGTGCCTACAGAGG + Intergenic
1062540786 9:137040834-137040856 TGCCCTCCCCGGGGCTCCAGGGG + Exonic
1203435032 Un_GL000195v1:130230-130252 TTCCAGCCCCGTGCCTGCAGAGG - Intergenic
1187705735 X:22007624-22007646 TGGACGTCCTGTGCCTCCAGAGG + Intergenic
1189253251 X:39617534-39617556 TTCCCGGCCCCTGCCTCCAGAGG - Intergenic
1196389177 X:115190897-115190919 TGCTCGCCCGAGGCCTACAGTGG + Exonic
1199974380 X:152884343-152884365 TGCCCTCCCGTGGCCTCAAGGGG + Intergenic
1200166490 X:154039206-154039228 TGCCCACCCTGTGTCACCAGAGG + Intronic
1200897004 Y:8386327-8386349 TGCCTGTACTGTGCCTCCAGAGG - Intergenic