ID: 1113082326

View in Genome Browser
Species Human (GRCh38)
Location 13:106533217-106533239
Sequence TGCCCGCCCGGTGCCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113082326_1113082337 30 Left 1113082326 13:106533217-106533239 CCTCTGGAGGCACCGGGCGGGCA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1113082337 13:106533270-106533292 GCCCGCCCGCCCGCCTCTCCCGG 0: 1
1: 0
2: 10
3: 70
4: 485
1113082326_1113082330 -10 Left 1113082326 13:106533217-106533239 CCTCTGGAGGCACCGGGCGGGCA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1113082330 13:106533230-106533252 CGGGCGGGCAGCGGCGCCGCGGG 0: 1
1: 0
2: 7
3: 63
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113082326 Original CRISPR TGCCCGCCCGGTGCCTCCAG AGG (reversed) Intronic