ID: 1113084443

View in Genome Browser
Species Human (GRCh38)
Location 13:106553952-106553974
Sequence ATAAAACAAAGGCTAGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113084443_1113084447 -7 Left 1113084443 13:106553952-106553974 CCACACCCTAGCCTTTGTTTTAT 0: 1
1: 0
2: 1
3: 23
4: 343
Right 1113084447 13:106553968-106553990 GTTTTATTCTACTACCCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113084443 Original CRISPR ATAAAACAAAGGCTAGGGTG TGG (reversed) Intronic
901943212 1:12679707-12679729 AAAAAAAAAAGGGTGGGGTGAGG + Intergenic
904478447 1:30779151-30779173 TTCAAACAAAGGCTAATGTGTGG - Intergenic
904529477 1:31158830-31158852 AAAAAAAAAAAGCCAGGGTGAGG + Intergenic
904541351 1:31235756-31235778 AAAAACCAAAGCCTAGAGTGTGG + Intronic
905954732 1:41982878-41982900 ACAATACAAAGTCTAGTGTGAGG + Intronic
906218395 1:44058269-44058291 ACAAAAAAAAGGCGATGGTGAGG - Intergenic
908400776 1:63771308-63771330 AAAAAAAAAATGCTGGGGTGGGG - Intergenic
909385566 1:75052076-75052098 ATAAATGAAAGGCTGGCGTGTGG - Intergenic
909899938 1:81120678-81120700 ATAAAATAAAGCCTTGGGTGAGG - Intergenic
911776281 1:101817126-101817148 TTTGAACAAAGGCTAGTGTGAGG - Intronic
914404464 1:147357580-147357602 ATTAAAGAATGGCTAGGGAGTGG + Intergenic
914803949 1:150979101-150979123 ACAAAACAAAACCTAGGGAGAGG + Intergenic
915101108 1:153500922-153500944 AGAAAGCAAAGGAAAGGGTGAGG - Intergenic
915183631 1:154084793-154084815 AAAAAAAAAAGGCTGGGGTTGGG + Intronic
915505842 1:156355779-156355801 AAAAAAAAAAGGCGGGGGTGGGG - Intronic
916042872 1:160976277-160976299 ATAATAAAAATGTTAGGGTGAGG - Intergenic
916121207 1:161529846-161529868 AAAAAAAAAAGGCTGGGGAGCGG + Intergenic
917241318 1:172951536-172951558 ATAAAGCAAAGTATGGGGTGGGG - Intergenic
919301625 1:195775972-195775994 AACAAATAATGGCTAGGGTGTGG - Intergenic
1063375561 10:5552301-5552323 AAGAAACAAACTCTAGGGTGTGG + Intergenic
1063446149 10:6118747-6118769 AAAAAAAAAAGGATTGGGTGCGG - Intergenic
1063892416 10:10644050-10644072 AGAAAACAAAGGCAAGGCTTGGG - Intergenic
1064946842 10:20800137-20800159 ATAAAACAATGGTTACGATGGGG - Intronic
1065228276 10:23569875-23569897 ATTAAACAAAGGCTCGAGTCTGG - Intergenic
1065592377 10:27278233-27278255 ATAACACAAAGTATAGGGAGGGG - Intergenic
1065657971 10:27972132-27972154 ATAACACAAAGTATAGGGAGGGG + Intronic
1065696381 10:28384574-28384596 AAAAAGCAAAGGCTAGGTTTTGG + Intergenic
1065712495 10:28532178-28532200 AAATAACAAGGGGTAGGGTGGGG + Intergenic
1067933067 10:50582851-50582873 ATAACACAGAGGCAAGTGTGGGG + Intronic
1070256565 10:74818196-74818218 AAAAAAAAAAGGCTCAGGTGTGG + Intergenic
1072420554 10:95287526-95287548 ATAAAAGACAGGAAAGGGTGAGG - Intronic
1073251838 10:102124937-102124959 AAAAAACAAGGGCCAGGGTCAGG - Intergenic
1073568454 10:104555710-104555732 AAAAGACAAAGGGTAGGGAGAGG + Intergenic
1074919557 10:117993395-117993417 ATTAGACAAAGGCTTGGGGGTGG + Intergenic
1075194798 10:120347028-120347050 AAAAAAAAAAGGCTAAGATGAGG - Intergenic
1075936808 10:126349986-126350008 ATGAAACAAAGGCTACTATGTGG - Intronic
1076527984 10:131124372-131124394 CCAAGACAAAGGCTGGGGTGGGG - Intronic
1077705479 11:4481333-4481355 ACAAAAGAAAAGATAGGGTGGGG + Intergenic
1079366429 11:19814147-19814169 ATAAACCAAAGGCCAAGCTGAGG + Intronic
1079434366 11:20432103-20432125 ATAAAAGAAAGGCTAGGAAGTGG - Intronic
1081523750 11:43908706-43908728 ATAATACTAGGGATAGGGTGGGG - Intronic
1082831621 11:57622728-57622750 TGAAAATAAAGGCTAGAGTGGGG - Intergenic
1083066615 11:59930572-59930594 ATCAAGAAAAGGCTAGGGGGTGG - Intergenic
1083412894 11:62506027-62506049 AAAAAAAAAAGGCGGGGGTGGGG + Intronic
1083946510 11:65926294-65926316 ATAAAAGAAAGGCAAGGGAATGG + Intergenic
1084923947 11:72496628-72496650 ATAAAACAAAGGAAGTGGTGGGG + Intergenic
1085753996 11:79188784-79188806 CTAAAGCCAAGGATAGGGTGTGG + Intronic
1087322178 11:96676673-96676695 ATAATAAAAAGATTAGGGTGGGG - Intergenic
1087657875 11:100947857-100947879 AAGAAACAAAGACTAGGGAGAGG - Intronic
1087730311 11:101771319-101771341 ATAAAATAAAGGTCAGTGTGTGG - Intronic
1088017299 11:105076667-105076689 ATAAAACAAATCCTAGGATAAGG - Intronic
1088408559 11:109507969-109507991 AGACAACAAATGCTAGGGTTTGG + Intergenic
1088768111 11:113005048-113005070 ATAAAACAAGAGCTTGGGGGAGG - Intronic
1089032686 11:115349426-115349448 CTAAAACAATGGCTAGTTTGGGG + Intronic
1089033702 11:115361879-115361901 ACAAAACAAAAACTCGGGTGTGG - Intronic
1089918642 11:122185274-122185296 ATAACAGAGAGGCAAGGGTGAGG - Intergenic
1090200859 11:124855011-124855033 ATGGGACAAAGGATAGGGTGTGG - Intergenic
1090718578 11:129452391-129452413 ATAAAACAAAGGATTGGGCCAGG + Intergenic
1091019143 11:132082878-132082900 ATGAAACAAAAGCGAGGGTAAGG + Intronic
1092076180 12:5675519-5675541 CTATAAGAAAGGCTAGGGTTTGG - Intronic
1092823986 12:12379907-12379929 TTAAATCAAAAGCTAGAGTGAGG - Intronic
1093350556 12:18094904-18094926 CTAAACCTAAGGCAAGGGTGAGG - Intronic
1094611342 12:31998341-31998363 TTAAAAAATAGGCTTGGGTGCGG - Intergenic
1095298176 12:40550892-40550914 ATAAAAAAAAGACTAGTGTATGG - Intronic
1095444563 12:42271128-42271150 ATGAAACAAAGGCCACGGAGGGG + Intronic
1097797465 12:63879303-63879325 AAAGAACAAAGGACAGGGTGAGG - Intronic
1099582083 12:84462251-84462273 ATATAACAAATGTTAGGATGTGG - Intergenic
1099634929 12:85201412-85201434 ATCAAACAAAGCCCAGGATGAGG - Intronic
1099831876 12:87854441-87854463 ATAAAACAATGTCTGAGGTGTGG + Intergenic
1100591340 12:96033134-96033156 ACAAAACAAAGGTAAGTGTGAGG + Intronic
1100774777 12:97961936-97961958 AGAAGACATAGGCTGGGGTGGGG + Intergenic
1100867121 12:98868815-98868837 CTAAAATAAAGGGTAGGGTGGGG + Intronic
1101851871 12:108409763-108409785 AGTAAACAAAGGGGAGGGTGGGG + Intergenic
1102319571 12:111919812-111919834 AAAAAAAAAAGGTGAGGGTGGGG + Intergenic
1103069128 12:117926246-117926268 AGAAAACCAAGGCTGGGATGGGG - Intronic
1104000320 12:124855974-124855996 AGAAACCAAAGGCCAGGGTAAGG + Intronic
1104129585 12:125880317-125880339 ATAAAACAAAAGACAAGGTGAGG + Intergenic
1104617243 12:130281137-130281159 AAAAAATAAAGGGGAGGGTGGGG + Intergenic
1105484873 13:20818811-20818833 AAAAAACAAAGGGGAGGGGGAGG - Intronic
1105845864 13:24293013-24293035 AAAAAAAAAAGGCGAGGGTGTGG + Intronic
1106351499 13:28935451-28935473 AAAAAAAAAAGGCTTTGGTGAGG - Intronic
1106911315 13:34466146-34466168 GTAAAACAAATTCCAGGGTGGGG - Intergenic
1108258233 13:48630986-48631008 ATGAACCAAAAGCCAGGGTGAGG - Intergenic
1109055805 13:57546990-57547012 AAAAATCAAATACTAGGGTGAGG - Intergenic
1109865786 13:68261129-68261151 ATAAAACAAGGGGAAGGGTAAGG - Intergenic
1110222144 13:73084938-73084960 ATAAAACAGAGGGCTGGGTGCGG + Intergenic
1110587799 13:77215190-77215212 CTTAATCAAAGGATAGGGTGAGG + Intronic
1110659320 13:78040641-78040663 AGAAACCAAAGTCTAGGGGGTGG + Intergenic
1112380223 13:98882105-98882127 CTAAAACAAAGGGAAGGCTGTGG + Intronic
1113084443 13:106553952-106553974 ATAAAACAAAGGCTAGGGTGTGG - Intronic
1114449513 14:22815803-22815825 AGAGAAGAGAGGCTAGGGTGGGG - Exonic
1114651337 14:24286548-24286570 ATAAAAGAAAGGACAGAGTGAGG - Intergenic
1117729910 14:58712074-58712096 ATAAAACAAAGACTCTGATGTGG + Intergenic
1118057836 14:62100364-62100386 AAAAAAAAAAGGGTGGGGTGGGG - Intronic
1118648503 14:67865229-67865251 AAAAAAAAAAGGCAAGGGGGAGG - Intronic
1119004269 14:70908895-70908917 CTAAAGCACAGGTTAGGGTGGGG + Intronic
1122293244 14:100690826-100690848 AGAAAACCAAAGCTAGGGAGGGG - Intergenic
1122399846 14:101460220-101460242 ATAAAAAAATGGTTAGGCTGGGG - Intergenic
1122543012 14:102508300-102508322 ATAAAGAAAAGGCCAGGGAGGGG + Intronic
1123585980 15:21761011-21761033 CTATAAGAAAGGCTAGGGTTTGG + Intergenic
1123622621 15:22203601-22203623 CTATAAGAAAGGCTAGGGTTTGG + Intergenic
1124434848 15:29638584-29638606 AAAAAACAAAGGGCTGGGTGTGG + Intergenic
1126732346 15:51696709-51696731 TAAAAGCAAAGGCAAGGGTGGGG + Intronic
1126980995 15:54242928-54242950 ATAAAACAAAGGTGAGGAGGGGG - Intronic
1127243702 15:57148216-57148238 AAGAAAGAAAGGCTAGAGTGGGG + Intronic
1128434688 15:67635091-67635113 ATAAAACAAAGGCTGGGATGAGG - Intronic
1130235437 15:82128737-82128759 AACAAACAGAGGCTAGGGTTTGG + Intergenic
1132219206 15:100092729-100092751 TTAAAAGAAAGGGTGGGGTGAGG - Intronic
1132876642 16:2142557-2142579 AAAAAAAAAAGGGCAGGGTGCGG + Intronic
1133069942 16:3239201-3239223 AAAAAAAAAAGCCTAGGCTGGGG - Intergenic
1133272927 16:4619459-4619481 ATAAATCAAAGAATGGGGTGAGG - Intronic
1133586714 16:7202805-7202827 ATAAACTAATGGCCAGGGTGGGG - Intronic
1134868814 16:17632997-17633019 ATCAAACACAGGCCAGGATGTGG + Intergenic
1137314480 16:47302073-47302095 ATAAAAGCAATGCTATGGTGTGG + Intronic
1137509551 16:49086967-49086989 ATTAAACATAGGCTGGAGTGGGG - Intergenic
1139547364 16:67655966-67655988 ACGAACAAAAGGCTAGGGTGTGG + Intronic
1140919112 16:79520444-79520466 AGAGAAGAGAGGCTAGGGTGTGG - Intergenic
1143735077 17:8905815-8905837 AAAAAAGAAAGGCTAGAATGAGG - Intronic
1146385190 17:32364651-32364673 ATAAAACGCAGGCTAGGGCCGGG - Intronic
1146458950 17:33028679-33028701 ATAAAAGATAAGTTAGGGTGGGG - Intronic
1146767953 17:35540891-35540913 ATAAAATATGGGGTAGGGTGGGG - Intergenic
1147879349 17:43643890-43643912 ATAAAAGAAAGTTTGGGGTGGGG - Intronic
1149775327 17:59352692-59352714 CTAAAGCAAAGGCTGGGGTGTGG + Intronic
1155447752 18:25929705-25929727 GTGAAATAAAGGCTAGGCTGGGG + Intergenic
1155490933 18:26401300-26401322 AAAAAAAAAAGTCTGGGGTGAGG - Intergenic
1156890642 18:42186260-42186282 ATAAAGAAAAGGGGAGGGTGTGG + Intergenic
1156892660 18:42208037-42208059 TTAAAACAAAGGCAAGAGGGAGG + Intergenic
1157083754 18:44555917-44555939 ATAAAACACAGGAGAGGATGCGG + Intergenic
1158971648 18:62673748-62673770 ATGTAACAAAGACTGGGGTGGGG - Intergenic
1159168615 18:64734572-64734594 AAAAACCAAAGGCAAAGGTGTGG + Intergenic
1159828490 18:73244021-73244043 ATAAATAAAAGTTTAGGGTGGGG + Intronic
1161547800 19:4892520-4892542 AAAAAAAAAAAGCTGGGGTGTGG - Intronic
1161638896 19:5407178-5407200 AAAAAAAAAAGGCTAGGGGCTGG + Intergenic
1161859900 19:6790192-6790214 ATAAAATAAATGCTGGGGAGAGG + Intronic
1162091682 19:8284367-8284389 AAAAAAAAAAGGCGAGGGGGAGG + Intronic
1162093919 19:8299214-8299236 AAAAAAAAAAGGCGAGGGGGAGG + Intronic
1162210403 19:9086989-9087011 AAAGAAGAAAAGCTAGGGTGGGG - Intergenic
1163575449 19:18108740-18108762 AGAAACCAAAGGCCGGGGTGGGG + Intronic
1165043803 19:33088331-33088353 AAAAAAAAAAAGCAAGGGTGAGG - Intronic
1165164388 19:33841267-33841289 ATAAAACAAAGGCAAGCCAGAGG - Intergenic
1166411851 19:42560782-42560804 TTAAAACTGAGGCTAAGGTGGGG + Intronic
1166422861 19:42652334-42652356 ATAAAACACAGCCTAGCCTGTGG + Intronic
1166823218 19:45593208-45593230 AAAAAAAAAAAGGTAGGGTGTGG + Intronic
1167113600 19:47476015-47476037 AAAAAAAAAAGGCCAGGGTGTGG + Intronic
1168093106 19:54098693-54098715 ATAAAAATAAGGGTCGGGTGAGG + Intronic
926746143 2:16159848-16159870 TTAAAACAGAGTCTAGTGTGAGG + Intergenic
927255554 2:21037688-21037710 ATCAAACAAAAGCAGGGGTGGGG + Intronic
927891938 2:26756570-26756592 TGAAGACAAGGGCTAGGGTGAGG - Intergenic
929156582 2:38793834-38793856 ATAAAACTAAGCCTAGCATGTGG + Intergenic
929305135 2:40352988-40353010 TTAAAAATAAGGCTGGGGTGTGG - Intronic
930315616 2:49793605-49793627 ATAAAACAGAAGTTAGGGAGGGG + Intergenic
930619752 2:53631366-53631388 ATAAAACAAACTGTAGGGTTTGG + Intronic
931179476 2:59884983-59885005 ATAAACCAAATGCTTGGGTAGGG - Intergenic
931346935 2:61455170-61455192 ACAAACAAAAGGCTGGGGTGTGG - Intronic
931545622 2:63382330-63382352 ATAAAACAAAGATTGGGGGGTGG + Intronic
931734218 2:65179333-65179355 AAAAAAAAAAGGCTGGGTTGTGG - Intergenic
934103022 2:88671049-88671071 ACAAAACAAAAGGTTGGGTGCGG - Intergenic
934727498 2:96633411-96633433 AAAAAACAAAAATTAGGGTGTGG + Intronic
935022159 2:99241980-99242002 AAAAGACAAAGGCTCGGGTAAGG + Intronic
935302356 2:101703629-101703651 AAAAAAAAAAGGCGGGGGTGGGG + Intronic
935960741 2:108423507-108423529 ATAAAAGAAAAACTAGGGTCTGG + Intergenic
936476428 2:112843942-112843964 ATAAACCAACTGCTAGGGAGAGG + Intergenic
936662926 2:114562024-114562046 ATAAAACAAGACCTAGGGAGTGG - Intronic
936771586 2:115920262-115920284 ATAATAAAAAGATTAGGGTGGGG - Intergenic
937412651 2:121689879-121689901 ATAGAAGGAAGGCCAGGGTGAGG + Intergenic
938813455 2:134875154-134875176 ATAAAAAAAAGAGTTGGGTGTGG - Intronic
938935517 2:136124230-136124252 AAAAAAGAAAGGATAGGGTTAGG + Intergenic
939174141 2:138730181-138730203 AAAAAAAAAAGGGTGGGGTGGGG - Intronic
940612883 2:156012166-156012188 AAAAAAGAGAGACTAGGGTGTGG - Intergenic
940707318 2:157121712-157121734 ATAGAACAAAGGTTGGGATGGGG + Intergenic
941562770 2:167069478-167069500 ATAAGACAAAGATTAGAGTGTGG - Intronic
941637544 2:167951527-167951549 ATAAAACAATTTCTAGGCTGAGG + Intergenic
941743857 2:169065513-169065535 GCAAAACAAAGGCAAGGATGAGG - Intronic
942946439 2:181679510-181679532 AGAAAAGAAAGGCGAGGGAGGGG - Intronic
942957007 2:181785173-181785195 ATAAAACAAAAGATAAAGTGTGG - Intergenic
943187640 2:184633045-184633067 AAAAAAGAAAGGGTGGGGTGGGG - Intronic
943359719 2:186902641-186902663 ATAAGACATTGACTAGGGTGAGG + Intergenic
943549199 2:189318380-189318402 AGAAATCAAAGGCTAAAGTGAGG - Intergenic
945030424 2:205658107-205658129 ATAAAACATAGGTTAGGTTAGGG - Intergenic
945375251 2:209072278-209072300 ATAAAAGAAAGGCTAGAATAAGG - Intergenic
946251864 2:218418927-218418949 AAAAAAAAAAGCCAAGGGTGGGG + Intergenic
946475757 2:220005099-220005121 AGAAAACAAAGGCCAGAGTGGGG + Intergenic
946533374 2:220599039-220599061 ATAAAATAAACGCTAGGTTGAGG + Intergenic
946725177 2:222655202-222655224 ATAAAAAAAAAAATAGGGTGGGG + Intronic
946953208 2:224899535-224899557 ATAAAACAAAGGAAAGGGGCTGG + Intronic
947200017 2:227606824-227606846 ATAGAACAAAAGATAGAGTGAGG - Intergenic
948651151 2:239444740-239444762 ATAAAACACAAGGGAGGGTGAGG + Intergenic
1168901006 20:1364966-1364988 TTCAAACAGAGGGTAGGGTGGGG + Intronic
1169375016 20:5059580-5059602 ATAAAATAAAGGCAAGGATATGG - Intergenic
1169761243 20:9097220-9097242 AAAAAAAAAAGGCCAGGCTGTGG - Intronic
1172065178 20:32214689-32214711 ATAAAACACAGGCAAAGGTTAGG - Intronic
1172211025 20:33198681-33198703 AAAAAACAAAAGGCAGGGTGAGG - Intergenic
1174330283 20:49812463-49812485 AGGAAACTAAGGCTCGGGTGGGG + Intergenic
1174499619 20:50975215-50975237 AAAAAAAAAAGGCTAGGGACAGG - Intergenic
1175438524 20:58973127-58973149 AGAAAACAAAAGCCAGGGGGAGG + Intergenic
1177821600 21:26036252-26036274 AAACCACAAAGGCTAGGGTGGGG + Intronic
1178195657 21:30342073-30342095 ATAAAACTAAGACAAGGATGAGG - Intergenic
1178291945 21:31376125-31376147 AAAAAACAAAGGGTAGGATGTGG - Intronic
1178616749 21:34141304-34141326 ACAAAACAAAGCCTTGAGTGAGG + Intronic
1181816322 22:25439685-25439707 AAAAAAAAAAGGCGGGGGTGGGG - Intergenic
1183247832 22:36707739-36707761 ATAATACAAAGGATATTGTGAGG + Intergenic
1184228746 22:43146280-43146302 ATAAAAAAAAGGGCTGGGTGCGG + Intergenic
950507011 3:13401271-13401293 AAAAAAAAAAGGCAATGGTGCGG + Intronic
951126651 3:18992598-18992620 AGAAAAAAAAGGCTAGTGGGCGG - Intergenic
951933109 3:27992095-27992117 ATTTAACAAAGGCCAGGGTTTGG - Intergenic
953388439 3:42520565-42520587 TTAAACCTAAGCCTAGGGTGGGG - Intronic
955078960 3:55640145-55640167 AGAAAATCAAGGCAAGGGTGTGG - Intronic
956026975 3:64993449-64993471 AAAAAACAAGGGCCAGGGGGTGG + Intergenic
956648324 3:71479127-71479149 TTAAAACAAAGGATAGGGCTGGG + Intronic
956974972 3:74568753-74568775 ATAAAACAAAGAAGAGGCTGTGG - Intergenic
957204586 3:77179810-77179832 TTTAAACAACTGCTAGGGTGCGG + Intronic
957502746 3:81077988-81078010 AAAAAAAAAAGGCTGGGGTGGGG + Intergenic
961186760 3:124921877-124921899 ATAAAACAATGGGTATGGTATGG + Intronic
961364047 3:126388308-126388330 ATGAAGCCAAGGCTGGGGTGGGG + Intergenic
962654108 3:137525219-137525241 GGAAAACAAAGGCTGAGGTGAGG + Intergenic
963025775 3:140917475-140917497 ATAAAAGAAAGCCTGGTGTGGGG - Intergenic
963475959 3:145805081-145805103 ATAATACAAAGGCAAGTGTGGGG + Intergenic
963752893 3:149201414-149201436 ATAAAACCCAGGCTAGGGCCAGG - Intronic
964796291 3:160501308-160501330 AAAAAAAAAAGGATTGGGTGGGG + Exonic
966484731 3:180455290-180455312 AAAAAACAAAGCATAAGGTGAGG - Intergenic
967100113 3:186209501-186209523 TTGAAATAAAGGCTATGGTGGGG + Intronic
967423068 3:189295038-189295060 ATAAAACAAAGGCGTGAATGTGG - Intronic
968188285 3:196648873-196648895 ATCAAAGAAAGGCTGGAGTGGGG - Intronic
968280826 3:197475474-197475496 AAAAAAAAAAGGTTGGGGTGGGG + Intergenic
968328593 3:197843990-197844012 ATAAAAGAGATGGTAGGGTGAGG + Intronic
970293287 4:14600603-14600625 TTAAAACACAGGGTAGGTTGGGG - Intergenic
970645572 4:18116735-18116757 AGAAAGCAAAGGCTAGAGAGAGG - Intergenic
970842397 4:20489796-20489818 ATAAAAAATAGGCCGGGGTGTGG + Intronic
970875583 4:20865682-20865704 ATAAAACAATGGTTAAAGTGGGG + Intronic
971537042 4:27766101-27766123 GTAAAACAATGCTTAGGGTGTGG + Intergenic
972275400 4:37552669-37552691 ATAAAAAAAAGCCTGGCGTGTGG - Intronic
972543968 4:40062764-40062786 ATAAAACAAAAGTGAGGGTAAGG - Intronic
973029207 4:45313850-45313872 ATAAAACAAGGTCTGGGTTGGGG + Intergenic
974373968 4:61052486-61052508 ATGAAACAATGGCAAGGTTGGGG - Intergenic
974860070 4:67509778-67509800 AGAAAAACAAGGCTAGGGAGGGG - Intronic
975126950 4:70793734-70793756 AAAAAACAAAAGCCATGGTGGGG - Intronic
976245487 4:83002366-83002388 CTAAAAAAAAAGCAAGGGTGAGG + Intronic
978331705 4:107620531-107620553 TTTAAATAAAGGCTAGAGTGTGG + Intronic
978465314 4:109002524-109002546 ATAGAACAAAGGCTGGAGGGTGG + Intronic
978587524 4:110289706-110289728 AGAAAAAAAAGGCTGGGGGGTGG + Intergenic
978902194 4:113964796-113964818 ATTTCAGAAAGGCTAGGGTGGGG - Intronic
979015305 4:115424689-115424711 ATGAAACAAGGGGTAGGGTAAGG - Intergenic
979118617 4:116862541-116862563 ATATTACACAGGCTAGTGTGTGG - Intergenic
979414138 4:120416144-120416166 ATAAAACAAGTGATAGGGTTAGG + Intergenic
979524134 4:121699215-121699237 AGAAAATAAAGGCTAGGGAATGG + Intergenic
980709066 4:136540679-136540701 TTAAAAAAAATGCTGGGGTGGGG + Intergenic
981243397 4:142506102-142506124 ATTAGACAAAGTCTAGGGTTTGG - Intronic
982292646 4:153793743-153793765 ATAAATAAAAGGCTAGAGTAAGG - Intergenic
982604744 4:157500143-157500165 ATGAAATAAAGGCTCAGGTGAGG + Intergenic
983631041 4:169849600-169849622 AGAAAACCAAGTCTAGGGTGGGG + Intergenic
984468667 4:180135650-180135672 ATAAAACACAGGCAAGGCAGTGG - Intergenic
987274860 5:16351852-16351874 ATAAAACAAAGGAGAGGGACAGG + Intergenic
987379605 5:17272802-17272824 ATAAAACAAAGAATAGAATGTGG + Intronic
988629425 5:32913094-32913116 ATAATAAAAAGATTAGGGTGGGG + Intergenic
989387906 5:40871614-40871636 ATAATTCAGAGGCTAGGGGGTGG + Intergenic
991250569 5:64556682-64556704 AAAAAACAAAGGCTAAGAAGTGG - Intronic
991728239 5:69558696-69558718 ATAAAATAAAGGCAATGGAGGGG + Intergenic
991866716 5:71069179-71069201 ATAAAATAAAGGCAATGGAGGGG - Intergenic
992821353 5:80500221-80500243 ACAAAACAATGGCTATGGGGAGG + Intronic
992878926 5:81085925-81085947 TTATAACAAAGGCTTGGGAGAGG + Intronic
993259209 5:85637741-85637763 AGAAAACAGAGGCTGGGGAGAGG + Intergenic
993487361 5:88503216-88503238 AAAAAAAAAAGGCTGGGGGGAGG + Intergenic
993506125 5:88710511-88710533 ATAAAACAAATGCTGGTGTTTGG + Intergenic
994381449 5:99076745-99076767 AAAAAAAAAAGGTGAGGGTGGGG - Intergenic
995063125 5:107832716-107832738 ATTAAAAAAAGGGAAGGGTGAGG + Intergenic
995198153 5:109396767-109396789 AAAAAAAAAAGGCAGGGGTGGGG + Intronic
996612354 5:125397407-125397429 ATAAAACAAAGGCAAGATTGGGG + Intergenic
996759289 5:126971157-126971179 AGAAAAAACAGGCTAGGGCGCGG + Intronic
998905062 5:146896080-146896102 ATTAAAGAAAGGCTATGGTCAGG + Intronic
999121267 5:149211290-149211312 ATACATCAAAGGCTGGGGAGAGG - Intronic
1000200218 5:159002145-159002167 AAAAAAAAAAGGCTTGGGGGAGG - Intronic
1000305365 5:159989462-159989484 ATAAAACAAACACCAGAGTGCGG - Intergenic
1000389159 5:160705211-160705233 AGAAAACAAAGGATAAGGTTGGG - Intronic
1001139428 5:169131884-169131906 ATCAAACAAAGTCTAGAGAGAGG + Intronic
1001182190 5:169530851-169530873 ATAAAAGAGAAGCTTGGGTGAGG + Intergenic
1001810911 5:174627631-174627653 GAAGAAGAAAGGCTAGGGTGAGG - Intergenic
1003028509 6:2579833-2579855 AAAAAAAAAAAGGTAGGGTGTGG + Intergenic
1004979445 6:21007112-21007134 ATAAAACAAATGTCAGGGTTCGG + Intronic
1006459875 6:34152135-34152157 GTAGAACCAAGGCTAGAGTGTGG - Intronic
1007518739 6:42434835-42434857 ATAAAACAATGGGCCGGGTGTGG + Intronic
1007704892 6:43784507-43784529 GGAAAACAAAGGCTGGGGTTAGG - Intronic
1008310187 6:49959081-49959103 ATAAAACAATAACTAGGGAGGGG - Intergenic
1008738840 6:54580378-54580400 ATAAAACATTGGCAAGGATGTGG - Intergenic
1009636489 6:66271755-66271777 TCAAAACAAAGTCTAAGGTGCGG + Intergenic
1012000276 6:93645852-93645874 ATAAAACAAAGGCTAATGTTTGG - Intergenic
1018124098 6:160665311-160665333 ATAAAACATAGGGTCGAGTGCGG + Intergenic
1019769187 7:2872733-2872755 AAAAAAAAAAGGATGGGGTGAGG - Intergenic
1020242592 7:6407368-6407390 ATAAAAGAAACCCTAGGATGTGG - Intergenic
1021594726 7:22302770-22302792 AAAAAAAAAAGGCGGGGGTGGGG - Intronic
1022381831 7:29867556-29867578 AAAAAAAAAAAGCTGGGGTGTGG - Intronic
1022700659 7:32756742-32756764 AAAAAGCAATGGCTAGAGTGAGG + Intergenic
1023593709 7:41806341-41806363 AAAAAAAAAATTCTAGGGTGGGG + Intergenic
1025159029 7:56636905-56636927 TTACCACAAAGGCCAGGGTGGGG - Intergenic
1025727560 7:64081326-64081348 TTACCACAAAGGCCAGGGTGGGG + Intronic
1025953975 7:66168623-66168645 AAAAAAAAAAGGCAAGGGTGGGG - Intergenic
1026122544 7:67550382-67550404 ATAAGACCTAGGCTAGGGAGGGG - Intergenic
1026835039 7:73633069-73633091 AAAAAAAAAAAGGTAGGGTGGGG - Intergenic
1028957703 7:96712579-96712601 ATAAAATAAAGTCCAGGCTGAGG + Intergenic
1029937272 7:104440022-104440044 ATAATACAAAGCCTGGGGGGGGG + Intronic
1030074046 7:105721340-105721362 AAAAAATAAAGGGTTGGGTGGGG + Intronic
1031336593 7:120541043-120541065 ATAGAGCATGGGCTAGGGTGGGG - Intronic
1032173424 7:129604896-129604918 ATAAAGGAAAGGCTAAGGAGAGG - Intergenic
1032470433 7:132174673-132174695 AGAAAACTAAGGCCAGGGAGGGG - Intronic
1032579844 7:133094078-133094100 AAAAAAAAAAGGGTTGGGTGTGG - Intergenic
1032806420 7:135359433-135359455 ATAAATAAAAGACTAGGGTGTGG + Intergenic
1033289355 7:140069921-140069943 TTAAAACAAATCCTAGGGTTGGG + Intergenic
1034484973 7:151354311-151354333 AAAAAAAAAAAGCAAGGGTGGGG - Intronic
1036191256 8:6671982-6672004 ATAATACAAAGGGCAGGGAGAGG + Intergenic
1036746865 8:11415955-11415977 ATAAAAAATAGACAAGGGTGGGG + Intronic
1037351225 8:17959710-17959732 ATAAAACACAATCAAGGGTGTGG - Intronic
1039149653 8:34489806-34489828 ATAATACAAACCCTAAGGTGAGG + Intergenic
1040046838 8:42972976-42972998 ACAAAATAAATGCTGGGGTGGGG - Intronic
1040996323 8:53406334-53406356 TAAAAACAAATGCCAGGGTGAGG - Intergenic
1041399874 8:57430894-57430916 AAAACAAAAAGGCTAGGGTAGGG - Intergenic
1041525418 8:58800117-58800139 ATCAAAGAAAGGCCAGGGTAGGG - Intergenic
1042426082 8:68650465-68650487 AAAAAAAAAAGACTAGGGTGGGG - Intronic
1042639817 8:70921353-70921375 ATAAAACAAAAGCAAAGGTAGGG - Intergenic
1043280038 8:78452231-78452253 ATAAAGCAAAGATTAGGGAGAGG - Intergenic
1044267547 8:90201173-90201195 ATAAAACAATGGGTACGATGTGG - Intergenic
1044693110 8:94897428-94897450 AGAAAATAAAGGGTAGGGGGCGG + Intronic
1046007798 8:108506752-108506774 ATATAACAAAAATTAGGGTGGGG + Intergenic
1046059315 8:109117601-109117623 AGAGAATAAAGGCAAGGGTGTGG + Intronic
1046666194 8:117006249-117006271 ATAATACAAAGTCTTGGGGGAGG + Intronic
1046894152 8:119454855-119454877 AGTAAGCAAAGGCTAGGGTGGGG + Intergenic
1048281158 8:133106465-133106487 AAAAAGCAAAAGGTAGGGTGAGG + Intronic
1049025718 8:139987583-139987605 ATAAAACAAAATCTAGGATGTGG + Intronic
1050449734 9:5767442-5767464 ATAAAACAAAGGATTAGGTAAGG - Intronic
1050957465 9:11682819-11682841 CTAAAAAAAAGGTTAGAGTGAGG - Intergenic
1052232548 9:26171832-26171854 AAAAAACAAAGGGTAGGGAGGGG - Intergenic
1054479828 9:65651399-65651421 GTAAAACAAAGAGTAGGGTTAGG + Intergenic
1055226144 9:73998918-73998940 ATAAAATAAAGCTTAGGGTAGGG + Intergenic
1055279457 9:74657707-74657729 TTAAAACACAGGCAAGGGTAGGG + Intronic
1055469817 9:76600240-76600262 AGCAAACAAAGGCTAGTGTCTGG + Intergenic
1055731926 9:79287325-79287347 AGAAAACAAAAGATAGGGTGAGG - Intergenic
1055940355 9:81643524-81643546 ACAAAACAAAGGGCTGGGTGCGG - Intronic
1056851174 9:90085809-90085831 ATAAAGGAAAGCCTAGGATGTGG - Intergenic
1058057632 9:100465036-100465058 CTAGAATAAAGGGTAGGGTGCGG - Intronic
1058646852 9:107139006-107139028 CTAAAACACAGCCTGGGGTGAGG + Intergenic
1058884743 9:109314640-109314662 TTAAAAGAAAGGCTGAGGTGGGG - Intronic
1059148665 9:111926849-111926871 AAAAAAAAAAGGCTGGGGGGAGG - Intronic
1059511282 9:114850447-114850469 AAAAAAAAAAGGGTTGGGTGGGG + Intergenic
1059671388 9:116495784-116495806 ATAAAACGCTGCCTAGGGTGAGG + Intronic
1060921195 9:127421819-127421841 ATAAAACAAATTCTGGGGTCAGG - Intergenic
1061116103 9:128613342-128613364 AAAAAGCAAAGGCTACTGTGTGG - Intronic
1061490897 9:130943749-130943771 ATAATACAAAGGCGGGGGTGGGG + Intergenic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1062079109 9:134610602-134610624 ATAAAGCAAAGGCTAGAATATGG - Intergenic
1202783590 9_KI270718v1_random:24740-24762 GTAAAACAAAGAGTAGGGTTAGG - Intergenic
1187183112 X:16961983-16962005 AGATAACAAACGTTAGGGTGTGG + Intronic
1189593232 X:42537515-42537537 AAAAAAAAAAGGTTAGGCTGAGG + Intergenic
1190548667 X:51556479-51556501 TTAAAACAAAATCTAGGGAGTGG - Intergenic
1190745505 X:53319997-53320019 AAAAAAAAAAGGCGGGGGTGGGG + Intronic
1190749984 X:53353655-53353677 AAAAAATAAAGTCTAGGGTTGGG + Intergenic
1191737221 X:64399603-64399625 ATAAAACAGAGGCTTGGGCCAGG - Intergenic
1192340095 X:70257260-70257282 AAAAAAGAAAGGCAAGGCTGGGG + Intergenic
1193776787 X:85652098-85652120 AAAAGAATAAGGCTAGGGTGGGG - Intergenic
1194631288 X:96288232-96288254 AGATAACAAGGTCTAGGGTGTGG - Intergenic
1195837286 X:109131094-109131116 ATAAAACAAATCCTGAGGTGAGG - Intergenic
1195996496 X:110736933-110736955 AGGAAACAAAGGCTAGGAAGTGG + Intronic
1196461926 X:115941106-115941128 ATAGAACAAAGGGTAGGTTTGGG + Intergenic
1196976710 X:121166173-121166195 AGAAAACTGAGGATAGGGTGGGG - Intergenic
1197062358 X:122196193-122196215 ATAAAACAAGGGGAAGGGTAAGG - Intergenic
1197461947 X:126753884-126753906 ATAAAAAACAGCCTAGAGTGAGG + Intergenic
1197476764 X:126934297-126934319 AGCAAATAGAGGCTAGGGTGAGG - Intergenic
1198087852 X:133297233-133297255 TTAAAAGAAAGGTGAGGGTGGGG + Intergenic
1200833802 Y:7713105-7713127 AAAAGAAAAAGGCCAGGGTGGGG + Intergenic
1201144706 Y:11057883-11057905 ATAATACAAAGGACATGGTGGGG + Intergenic
1201519223 Y:14853803-14853825 ATATCACAAAGTATAGGGTGAGG - Intergenic