ID: 1113085582

View in Genome Browser
Species Human (GRCh38)
Location 13:106567208-106567230
Sequence TCTGCAGGCCGGCTCGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113085575_1113085582 3 Left 1113085575 13:106567182-106567204 CCAGCAAACGCTCACCACCCTCC 0: 1
1: 0
2: 4
3: 12
4: 194
Right 1113085582 13:106567208-106567230 TCTGCAGGCCGGCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 16
4: 111
1113085574_1113085582 7 Left 1113085574 13:106567178-106567200 CCGACCAGCAAACGCTCACCACC 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1113085582 13:106567208-106567230 TCTGCAGGCCGGCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 16
4: 111
1113085570_1113085582 28 Left 1113085570 13:106567157-106567179 CCCTTCTCTCTCCTCCTCAAGCC 0: 1
1: 3
2: 8
3: 116
4: 1126
Right 1113085582 13:106567208-106567230 TCTGCAGGCCGGCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 16
4: 111
1113085573_1113085582 14 Left 1113085573 13:106567171-106567193 CCTCAAGCCGACCAGCAAACGCT 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1113085582 13:106567208-106567230 TCTGCAGGCCGGCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 16
4: 111
1113085572_1113085582 17 Left 1113085572 13:106567168-106567190 CCTCCTCAAGCCGACCAGCAAAC 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1113085582 13:106567208-106567230 TCTGCAGGCCGGCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 16
4: 111
1113085571_1113085582 27 Left 1113085571 13:106567158-106567180 CCTTCTCTCTCCTCCTCAAGCCG 0: 1
1: 0
2: 4
3: 69
4: 517
Right 1113085582 13:106567208-106567230 TCTGCAGGCCGGCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 16
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113085582 Original CRISPR TCTGCAGGCCGGCTCGCTCC CGG Intronic
900181910 1:1314856-1314878 TCTTCAGGAAGTCTCGCTCCCGG + Exonic
901060813 1:6471145-6471167 CCTGCGGGCCGGCCCGCGCCAGG + Intronic
901245640 1:7728360-7728382 GCAGCAGGCAGGCTCGCTCCAGG + Intronic
903223650 1:21882978-21883000 TCTTCAGGCCTCCTCCCTCCTGG + Intronic
903973721 1:27136111-27136133 TCTAGAGGCAGTCTCGCTCCTGG + Intronic
905333988 1:37231709-37231731 TCTGCAGGCAGGTTTGCTGCTGG + Intergenic
907524032 1:55043532-55043554 TCTACGGGCCTGGTCGCTCCTGG - Intronic
913224057 1:116683277-116683299 TCTGCAGGCAGGCAGGCTCCAGG - Intergenic
914255375 1:145957951-145957973 TCGGCAGGCTGGCAGGCTCCGGG - Exonic
915071330 1:153271883-153271905 TCTAAAGGCCGGCTTGCTGCTGG + Intergenic
916042129 1:160970518-160970540 TCTGCAGGCAGGCTGTCTCCAGG + Intergenic
916127108 1:161581410-161581432 TCTGGGCGCCAGCTCGCTCCAGG + Intronic
916137028 1:161663214-161663236 TCTGGGCGCCAGCTCGCTCCAGG + Exonic
917782372 1:178411886-178411908 TCTGAAGGCCGACTGGCCCCAGG - Intronic
920027236 1:203007668-203007690 GCTGGAGGGCGGCTCGGTCCGGG + Intronic
1064670994 10:17713718-17713740 TCTGCTGGTCGGCTCTCTCCTGG + Intronic
1067796771 10:49326731-49326753 TCTGCAGGCCAGCGCCCTCATGG + Exonic
1069688587 10:70334986-70335008 TCTGCAGACAGGCTCCCCCCAGG + Intronic
1069980404 10:72248560-72248582 TCTGAAGGCCGGGTCCCACCTGG - Intergenic
1076874040 10:133207304-133207326 CCTGCAGGCCGGCACGCCGCTGG + Exonic
1077102906 11:830097-830119 GCTCCAGGCCGTCGCGCTCCCGG - Exonic
1077304929 11:1864759-1864781 TCTGCAGGCCGGCTCCCTGCAGG - Intronic
1077468240 11:2743932-2743954 TCTGCAGGCCAGCACCCTCAAGG - Intronic
1080404712 11:31968496-31968518 TCTGCAGGGCCCCTCGCTTCAGG - Intronic
1085718977 11:78896767-78896789 TCCCCAGGCTGGCTGGCTCCAGG - Intronic
1085784812 11:79440110-79440132 TCTGCAGACTAGCTCGCCCCAGG - Intronic
1089754471 11:120676440-120676462 TCTGCAGGCTGGGAAGCTCCAGG + Intronic
1091635190 12:2191403-2191425 TCTGCAGTCACGCTGGCTCCAGG + Intronic
1096298115 12:50401158-50401180 GCTGCAGGCCTGCTCGGCCCAGG - Intronic
1102007043 12:109595702-109595724 TCTGCCCTCAGGCTCGCTCCTGG + Intronic
1103628086 12:122235866-122235888 TCAGCAGGCCGGCCTTCTCCAGG + Exonic
1103952587 12:124559052-124559074 CCTGCAGGCCGGGTGGCTCCTGG - Intronic
1113085582 13:106567208-106567230 TCTGCAGGCCGGCTCGCTCCCGG + Intronic
1113919233 13:113897527-113897549 TCTGCAGGGCTGCTCTCTCAGGG - Intergenic
1114908632 14:27163960-27163982 CCTGCAGTTCGGCTCTCTCCAGG - Intergenic
1115713247 14:36073396-36073418 TCTGGAGGCCAGCTCTATCCAGG + Intergenic
1118849245 14:69572029-69572051 TCCGCAGGCCCTCTCGCTCCTGG + Exonic
1119926816 14:78502420-78502442 TCTTCAGGCTGGCTGCCTCCTGG + Intronic
1122510514 14:102263218-102263240 TGTGCAGGCCCGCTGGCTCAGGG - Intronic
1122812733 14:104297045-104297067 ACTGCAGGCAGGCACGCTTCTGG - Intergenic
1129189021 15:73927008-73927030 GCTGCTGGCCGGCGCGCCCCAGG + Exonic
1132596297 16:752014-752036 TCTCCAGGCCTGTTCCCTCCAGG + Intronic
1132948912 16:2549309-2549331 TCTGCAGGCATGCATGCTCCTGG + Intronic
1132965675 16:2652818-2652840 TCTGCAGGCATGCATGCTCCTGG - Intergenic
1133286461 16:4693120-4693142 CCTGCTGGCAGGCTCGATCCAGG - Intergenic
1133383640 16:5351439-5351461 ACTTCAGGCTGGCTCACTCCAGG + Intergenic
1142395078 16:89827744-89827766 TCTTCAGGCCGGGTCACTCCTGG - Intronic
1142855022 17:2724452-2724474 GCTGCGGGCCGGCTCGGTCCGGG + Intergenic
1149994192 17:61398346-61398368 TTTGAAGGCCGGATCTCTCCTGG - Intergenic
1151155358 17:72120517-72120539 CAGGCAGGCAGGCTCGCTCCAGG + Intergenic
1151351654 17:73535454-73535476 TCTGCAGTCCGGCTGCCTCCTGG + Intronic
1156468415 18:37362416-37362438 TCTGCAGCCCTGTTAGCTCCAGG + Intronic
1158938771 18:62388159-62388181 TCTTCAGGCCTGGTCCCTCCTGG + Exonic
1160528146 18:79549100-79549122 TTTGCAGGGCGGGTGGCTCCTGG - Intergenic
1160703637 19:519270-519292 CCTGGAGGCCGGCTCGCGCTTGG + Exonic
1163544418 19:17932683-17932705 TCTGGCGGCCGGGCCGCTCCAGG + Intergenic
1165112908 19:33512655-33512677 TGTGCAGGCCGGCTCCATCGTGG - Exonic
1168404411 19:56103289-56103311 TCTGCAGGCTGCCTCCCTGCAGG - Intronic
925169652 2:1743410-1743432 CCGGCCGCCCGGCTCGCTCCGGG + Intronic
925259845 2:2519861-2519883 TCTGCAGCCCGGGGAGCTCCTGG - Intergenic
925306638 2:2851479-2851501 TCTGGAGACAGGCTCCCTCCTGG + Intergenic
925494070 2:4426350-4426372 TCTGCAGGACAGCTGGCCCCAGG - Intergenic
925919230 2:8627861-8627883 TCTGCAGGGCGGCCTCCTCCGGG - Intergenic
926167551 2:10530936-10530958 TCACCAGCCCGGCTCGCTCAGGG + Intergenic
926336226 2:11864822-11864844 TCTGCAGCAGGGCTCACTCCAGG - Intergenic
926438080 2:12857879-12857901 TCTGCATTCGGGCTCTCTCCAGG + Intergenic
927505265 2:23609233-23609255 ACTGCAGGCCATCTCCCTCCTGG - Intronic
929151148 2:38750515-38750537 GCTGCGGGCCCGCGCGCTCCCGG - Intronic
931657701 2:64524753-64524775 TCTGCGGGCCTGCGGGCTCCCGG + Intronic
940279913 2:151978464-151978486 TATGCAGGCAGTCTGGCTCCAGG - Intronic
941772714 2:169361935-169361957 TCTGCTGGGCGGCGCGGTCCCGG - Intronic
943045908 2:182862198-182862220 TCTGCAGGCCTTCTCTCTCTTGG - Intronic
947463830 2:230324471-230324493 TCTGCAGGCAGGATGACTCCAGG + Intergenic
947472651 2:230412921-230412943 TCTGCAGGCAGGATGACTCCAGG + Intergenic
948469356 2:238167336-238167358 GCTGCAGGCCGACTCTTTCCTGG + Intronic
948513322 2:238487699-238487721 TCAGCAGGCCTGCTTCCTCCCGG - Intergenic
1171045724 20:21808295-21808317 TCTCCATGCCAGCTCCCTCCTGG - Intergenic
1172768449 20:37363406-37363428 TCTGCACCCAGGCTCCCTCCTGG + Intronic
1175262485 20:57683477-57683499 CATGCAGGGCTGCTCGCTCCAGG - Intronic
1179551323 21:42145815-42145837 TCTGCAGACCTGCAGGCTCCGGG + Intergenic
1179724473 21:43334116-43334138 TCTGCAACCCCGCTCGCCCCTGG - Intergenic
1182070173 22:27458020-27458042 TCTGCAGACCAGCTCACTCCAGG - Intergenic
1182585187 22:31340981-31341003 TCTGGAGGCCGACTCACTCGTGG + Intronic
1182897817 22:33873444-33873466 CCTGAAGGCCGTGTCGCTCCTGG + Intronic
1182913101 22:34004116-34004138 CCTGCAGGCTGGCTCCCTCCTGG - Intergenic
1184279032 22:43426699-43426721 TCTGCAGGGCAGCAGGCTCCAGG + Intronic
1184302590 22:43570918-43570940 TCTGCAGACCAGCCCGCCCCAGG - Intronic
1185250448 22:49799029-49799051 TCAGCAGGCGAGCGCGCTCCAGG + Exonic
951277693 3:20709963-20709985 TGTGCAGGCTGGCTAGCTCTGGG - Intergenic
951544612 3:23811377-23811399 TCTGCAGACCTGCACGCTACAGG + Intronic
960801530 3:121545424-121545446 TCTGTTGGGCGGCTCGTTCCTGG - Intronic
962834853 3:139181116-139181138 TCTGCAGGCAGGCTTGCTACTGG + Intronic
963107680 3:141660467-141660489 TCTCCAGGGAGCCTCGCTCCTGG - Intergenic
964400336 3:156291479-156291501 TCTGAATGCGGGCTCGCTTCTGG - Intronic
968084209 3:195867374-195867396 TCTGCTGGCCGGCCCGCCTCTGG + Exonic
969854174 4:9985723-9985745 GCTGATGGCCTGCTCGCTCCAGG - Exonic
995570459 5:113474653-113474675 TCTGCAGGCTTGCCCCCTCCAGG - Intronic
997081202 5:130740362-130740384 TGTGCAGGACTGCTCTCTCCAGG - Intergenic
1001622742 5:173102425-173102447 TCTGCAGGCAAGTTTGCTCCTGG + Intronic
1002139950 5:177132642-177132664 GCTGCAGCCCGGCTCGGTGCCGG + Intergenic
1002772516 6:301815-301837 TCTGGAGCCCGGCTTGCTGCAGG - Intronic
1003290651 6:4776204-4776226 CCTTCCTGCCGGCTCGCTCCCGG + Intronic
1004241819 6:13930324-13930346 TCTGCAGGGGGGCTGGCTCCAGG - Intronic
1007725959 6:43915725-43915747 TCTGCAGGGTGGGTTGCTCCTGG + Intergenic
1019428857 7:989305-989327 ACTGCAGGCCGACTGCCTCCAGG - Exonic
1019487911 7:1297727-1297749 TCTGCTTGCCTGCCCGCTCCCGG + Intergenic
1019635700 7:2074558-2074580 TCTGCAGGCTGGCAGGCTGCTGG + Intronic
1020014045 7:4820777-4820799 TCTGCAGCCCGGCCCCCGCCCGG + Intronic
1032863765 7:135905664-135905686 TCTGCAGGCCCTCTCCCTGCAGG - Intergenic
1034540461 7:151754925-151754947 TCTGCAGGAAGGGTCGCTGCAGG + Intronic
1035352716 7:158257803-158257825 TCTGCAGGCGGGCTCACCCCTGG - Intronic
1037743293 8:21624092-21624114 TCTGCAGGCTGGCTCTCTGATGG - Intergenic
1039057905 8:33551179-33551201 TCTGAAGTCCGGCTTGCCCCAGG - Intronic
1040501388 8:48008373-48008395 CGTGCAGGGCGGCGCGCTCCCGG + Intergenic
1042784854 8:72536516-72536538 CCTGCAGCCCCGCTCGCTCGGGG - Intergenic
1049509265 8:143019308-143019330 CCTGCCGGCTGGCTCCCTCCGGG + Intronic
1053434828 9:38067998-38068020 TCCGCAGGCCGTCGGGCTCCAGG + Exonic
1056271080 9:84948660-84948682 CCTGAAGGCCTGCTCCCTCCTGG - Intronic
1057443375 9:95097562-95097584 GCTGCTGGCCGGCTCACACCAGG + Intergenic
1061115468 9:128607977-128607999 TCTCCAGGTCTGCACGCTCCTGG - Exonic
1061116649 9:128617676-128617698 TCTGCACGCCGGTTAGGTCCCGG - Exonic
1061824034 9:133246864-133246886 TCTGCAGGCTCCCTCTCTCCGGG + Intergenic
1062217196 9:135395643-135395665 TCTGCAGGCAGGGTTGCCCCAGG - Intergenic
1062263398 9:135675051-135675073 TCTTCAGGCCACCTCACTCCCGG + Intergenic
1062400544 9:136370766-136370788 TCTGCAGGCCGGGGCGGTCGGGG - Intronic
1062582348 9:137234161-137234183 CCTGCTGGCCGGCTCCCTGCTGG + Exonic
1190246853 X:48696612-48696634 CCTGCCGCCCGGCTCGGTCCCGG - Intronic
1192657266 X:73004253-73004275 TCTGCTGGCTGGCTAGCTCCTGG - Exonic
1192664854 X:73078754-73078776 TCTGCTGGCTGGCTAGCTCCTGG + Exonic