ID: 1113086941

View in Genome Browser
Species Human (GRCh38)
Location 13:106578177-106578199
Sequence CCCTCTCGGCACCTTGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113086937_1113086941 -5 Left 1113086937 13:106578159-106578181 CCTGCAGAGAGACCGTGACCCTC No data
Right 1113086941 13:106578177-106578199 CCCTCTCGGCACCTTGATTGAGG No data
1113086933_1113086941 7 Left 1113086933 13:106578147-106578169 CCTCCCCTGGAACCTGCAGAGAG No data
Right 1113086941 13:106578177-106578199 CCCTCTCGGCACCTTGATTGAGG No data
1113086935_1113086941 3 Left 1113086935 13:106578151-106578173 CCCTGGAACCTGCAGAGAGACCG No data
Right 1113086941 13:106578177-106578199 CCCTCTCGGCACCTTGATTGAGG No data
1113086930_1113086941 27 Left 1113086930 13:106578127-106578149 CCAGAACGGCCAAGAAGGCGCCT No data
Right 1113086941 13:106578177-106578199 CCCTCTCGGCACCTTGATTGAGG No data
1113086932_1113086941 18 Left 1113086932 13:106578136-106578158 CCAAGAAGGCGCCTCCCCTGGAA No data
Right 1113086941 13:106578177-106578199 CCCTCTCGGCACCTTGATTGAGG No data
1113086936_1113086941 2 Left 1113086936 13:106578152-106578174 CCTGGAACCTGCAGAGAGACCGT No data
Right 1113086941 13:106578177-106578199 CCCTCTCGGCACCTTGATTGAGG No data
1113086934_1113086941 4 Left 1113086934 13:106578150-106578172 CCCCTGGAACCTGCAGAGAGACC No data
Right 1113086941 13:106578177-106578199 CCCTCTCGGCACCTTGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113086941 Original CRISPR CCCTCTCGGCACCTTGATTG AGG Intergenic
No off target data available for this crispr