ID: 1113088090

View in Genome Browser
Species Human (GRCh38)
Location 13:106588623-106588645
Sequence ACTTTGCCAGAGAGGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113088090_1113088097 -7 Left 1113088090 13:106588623-106588645 CCCCACAGCCTCTCTGGCAAAGT No data
Right 1113088097 13:106588639-106588661 GCAAAGTATGCTGGGGAACTTGG No data
1113088090_1113088098 -6 Left 1113088090 13:106588623-106588645 CCCCACAGCCTCTCTGGCAAAGT No data
Right 1113088098 13:106588640-106588662 CAAAGTATGCTGGGGAACTTGGG No data
1113088090_1113088099 -5 Left 1113088090 13:106588623-106588645 CCCCACAGCCTCTCTGGCAAAGT No data
Right 1113088099 13:106588641-106588663 AAAGTATGCTGGGGAACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113088090 Original CRISPR ACTTTGCCAGAGAGGCTGTG GGG (reversed) Intergenic
No off target data available for this crispr