ID: 1113088098

View in Genome Browser
Species Human (GRCh38)
Location 13:106588640-106588662
Sequence CAAAGTATGCTGGGGAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113088091_1113088098 -7 Left 1113088091 13:106588624-106588646 CCCACAGCCTCTCTGGCAAAGTA No data
Right 1113088098 13:106588640-106588662 CAAAGTATGCTGGGGAACTTGGG No data
1113088089_1113088098 -3 Left 1113088089 13:106588620-106588642 CCTCCCCACAGCCTCTCTGGCAA No data
Right 1113088098 13:106588640-106588662 CAAAGTATGCTGGGGAACTTGGG No data
1113088090_1113088098 -6 Left 1113088090 13:106588623-106588645 CCCCACAGCCTCTCTGGCAAAGT No data
Right 1113088098 13:106588640-106588662 CAAAGTATGCTGGGGAACTTGGG No data
1113088084_1113088098 18 Left 1113088084 13:106588599-106588621 CCTAGCAGCTACCAGTGCCACCC No data
Right 1113088098 13:106588640-106588662 CAAAGTATGCTGGGGAACTTGGG No data
1113088085_1113088098 7 Left 1113088085 13:106588610-106588632 CCAGTGCCACCCTCCCCACAGCC No data
Right 1113088098 13:106588640-106588662 CAAAGTATGCTGGGGAACTTGGG No data
1113088088_1113088098 -2 Left 1113088088 13:106588619-106588641 CCCTCCCCACAGCCTCTCTGGCA No data
Right 1113088098 13:106588640-106588662 CAAAGTATGCTGGGGAACTTGGG No data
1113088086_1113088098 1 Left 1113088086 13:106588616-106588638 CCACCCTCCCCACAGCCTCTCTG No data
Right 1113088098 13:106588640-106588662 CAAAGTATGCTGGGGAACTTGGG No data
1113088092_1113088098 -8 Left 1113088092 13:106588625-106588647 CCACAGCCTCTCTGGCAAAGTAT No data
Right 1113088098 13:106588640-106588662 CAAAGTATGCTGGGGAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113088098 Original CRISPR CAAAGTATGCTGGGGAACTT GGG Intergenic
No off target data available for this crispr