ID: 1113088928

View in Genome Browser
Species Human (GRCh38)
Location 13:106597143-106597165
Sequence TGGGATCCTAAAACAGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113088928_1113088933 8 Left 1113088928 13:106597143-106597165 CCTTTATCTGTTTTAGGATCCCA No data
Right 1113088933 13:106597174-106597196 CTTATATCTCCTTCAATCGGTGG No data
1113088928_1113088931 5 Left 1113088928 13:106597143-106597165 CCTTTATCTGTTTTAGGATCCCA No data
Right 1113088931 13:106597171-106597193 CTCCTTATATCTCCTTCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113088928 Original CRISPR TGGGATCCTAAAACAGATAA AGG (reversed) Intergenic
No off target data available for this crispr