ID: 1113089061

View in Genome Browser
Species Human (GRCh38)
Location 13:106598077-106598099
Sequence GACTCACGTTTACCCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113089061_1113089065 26 Left 1113089061 13:106598077-106598099 CCAGGCAGGGGTAAACGTGAGTC No data
Right 1113089065 13:106598126-106598148 AGTTGCCTCTCTCCTTGACCAGG No data
1113089061_1113089062 -5 Left 1113089061 13:106598077-106598099 CCAGGCAGGGGTAAACGTGAGTC No data
Right 1113089062 13:106598095-106598117 GAGTCCGCTGTGTCTCTACTAGG No data
1113089061_1113089066 30 Left 1113089061 13:106598077-106598099 CCAGGCAGGGGTAAACGTGAGTC No data
Right 1113089066 13:106598130-106598152 GCCTCTCTCCTTGACCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113089061 Original CRISPR GACTCACGTTTACCCCTGCC TGG (reversed) Intergenic
No off target data available for this crispr