ID: 1113089062

View in Genome Browser
Species Human (GRCh38)
Location 13:106598095-106598117
Sequence GAGTCCGCTGTGTCTCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113089056_1113089062 17 Left 1113089056 13:106598055-106598077 CCAGATTTGTACTTGCAATTTTC No data
Right 1113089062 13:106598095-106598117 GAGTCCGCTGTGTCTCTACTAGG No data
1113089061_1113089062 -5 Left 1113089061 13:106598077-106598099 CCAGGCAGGGGTAAACGTGAGTC No data
Right 1113089062 13:106598095-106598117 GAGTCCGCTGTGTCTCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113089062 Original CRISPR GAGTCCGCTGTGTCTCTACT AGG Intergenic
No off target data available for this crispr