ID: 1113089065

View in Genome Browser
Species Human (GRCh38)
Location 13:106598126-106598148
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113089061_1113089065 26 Left 1113089061 13:106598077-106598099 CCAGGCAGGGGTAAACGTGAGTC No data
Right 1113089065 13:106598126-106598148 AGTTGCCTCTCTCCTTGACCAGG No data
1113089063_1113089065 4 Left 1113089063 13:106598099-106598121 CCGCTGTGTCTCTACTAGGTAAT No data
Right 1113089065 13:106598126-106598148 AGTTGCCTCTCTCCTTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113089065 Original CRISPR AGTTGCCTCTCTCCTTGACC AGG Intergenic
No off target data available for this crispr