ID: 1113089323

View in Genome Browser
Species Human (GRCh38)
Location 13:106600396-106600418
Sequence CAGGATGACCTTCATGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113089323_1113089330 16 Left 1113089323 13:106600396-106600418 CCAAGCCCATGAAGGTCATCCTG No data
Right 1113089330 13:106600435-106600457 TAACATTTTATTACTCATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113089323 Original CRISPR CAGGATGACCTTCATGGGCT TGG (reversed) Intergenic
No off target data available for this crispr