ID: 1113089783

View in Genome Browser
Species Human (GRCh38)
Location 13:106605141-106605163
Sequence CTCCATGTTGAATAGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2398
Summary {0: 5, 1: 238, 2: 732, 3: 762, 4: 661}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113089783 Original CRISPR CTCCATGTTGAATAGGAGCT AGG Intergenic
Too many off-targets to display for this crispr