ID: 1113090314 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:106611174-106611196 |
| Sequence | TCCAAGCTTCAGATTCTACA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1113090314_1113090317 | 26 | Left | 1113090314 | 13:106611174-106611196 | CCCTGTAGAATCTGAAGCTTGGA | No data | ||
| Right | 1113090317 | 13:106611223-106611245 | AAGCAGTACATACATGAAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1113090314 | Original CRISPR | TCCAAGCTTCAGATTCTACA GGG (reversed) | Intergenic | ||