ID: 1113090315

View in Genome Browser
Species Human (GRCh38)
Location 13:106611175-106611197
Sequence CTCCAAGCTTCAGATTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113090315_1113090317 25 Left 1113090315 13:106611175-106611197 CCTGTAGAATCTGAAGCTTGGAG No data
Right 1113090317 13:106611223-106611245 AAGCAGTACATACATGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113090315 Original CRISPR CTCCAAGCTTCAGATTCTAC AGG (reversed) Intergenic