ID: 1113094181 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:106646349-106646371 |
| Sequence | AAGGGAAATCTTGATGGGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1113094181_1113094188 | 7 | Left | 1113094181 | 13:106646349-106646371 | CCTTCCCCATCAAGATTTCCCTT | No data | ||
| Right | 1113094188 | 13:106646379-106646401 | AGGAACTTAATGATCCAGCTTGG | No data | ||||
| 1113094181_1113094190 | 25 | Left | 1113094181 | 13:106646349-106646371 | CCTTCCCCATCAAGATTTCCCTT | No data | ||
| Right | 1113094190 | 13:106646397-106646419 | CTTGGAAAGACATGTTTACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1113094181 | Original CRISPR | AAGGGAAATCTTGATGGGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||