ID: 1113094181

View in Genome Browser
Species Human (GRCh38)
Location 13:106646349-106646371
Sequence AAGGGAAATCTTGATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113094181_1113094188 7 Left 1113094181 13:106646349-106646371 CCTTCCCCATCAAGATTTCCCTT No data
Right 1113094188 13:106646379-106646401 AGGAACTTAATGATCCAGCTTGG No data
1113094181_1113094190 25 Left 1113094181 13:106646349-106646371 CCTTCCCCATCAAGATTTCCCTT No data
Right 1113094190 13:106646397-106646419 CTTGGAAAGACATGTTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113094181 Original CRISPR AAGGGAAATCTTGATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr