ID: 1113094390

View in Genome Browser
Species Human (GRCh38)
Location 13:106648406-106648428
Sequence TTGAATATGAATGAGGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113094386_1113094390 1 Left 1113094386 13:106648382-106648404 CCTGAAATGCCTCGGTGAACTTT No data
Right 1113094390 13:106648406-106648428 TTGAATATGAATGAGGACTAGGG No data
1113094387_1113094390 -8 Left 1113094387 13:106648391-106648413 CCTCGGTGAACTTTCTTGAATAT No data
Right 1113094390 13:106648406-106648428 TTGAATATGAATGAGGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113094390 Original CRISPR TTGAATATGAATGAGGACTA GGG Intergenic
No off target data available for this crispr