ID: 1113095834

View in Genome Browser
Species Human (GRCh38)
Location 13:106663005-106663027
Sequence AACCCAGGACTGCTATTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113095834_1113095837 3 Left 1113095834 13:106663005-106663027 CCCGTCAATAGCAGTCCTGGGTT No data
Right 1113095837 13:106663031-106663053 AGACAGTCGTTTTTTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113095834 Original CRISPR AACCCAGGACTGCTATTGAC GGG (reversed) Intergenic
No off target data available for this crispr