ID: 1113096269

View in Genome Browser
Species Human (GRCh38)
Location 13:106667153-106667175
Sequence CTCTGTGACCACAGAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113096269_1113096272 -9 Left 1113096269 13:106667153-106667175 CCTTTCCCTCTGTGGTCACAGAG No data
Right 1113096272 13:106667167-106667189 GTCACAGAGAGACATGACGATGG No data
1113096269_1113096276 3 Left 1113096269 13:106667153-106667175 CCTTTCCCTCTGTGGTCACAGAG No data
Right 1113096276 13:106667179-106667201 CATGACGATGGGAGCAGGGCCGG No data
1113096269_1113096275 -1 Left 1113096269 13:106667153-106667175 CCTTTCCCTCTGTGGTCACAGAG No data
Right 1113096275 13:106667175-106667197 GAGACATGACGATGGGAGCAGGG No data
1113096269_1113096274 -2 Left 1113096269 13:106667153-106667175 CCTTTCCCTCTGTGGTCACAGAG No data
Right 1113096274 13:106667174-106667196 AGAGACATGACGATGGGAGCAGG No data
1113096269_1113096278 5 Left 1113096269 13:106667153-106667175 CCTTTCCCTCTGTGGTCACAGAG No data
Right 1113096278 13:106667181-106667203 TGACGATGGGAGCAGGGCCGGGG No data
1113096269_1113096273 -8 Left 1113096269 13:106667153-106667175 CCTTTCCCTCTGTGGTCACAGAG No data
Right 1113096273 13:106667168-106667190 TCACAGAGAGACATGACGATGGG No data
1113096269_1113096277 4 Left 1113096269 13:106667153-106667175 CCTTTCCCTCTGTGGTCACAGAG No data
Right 1113096277 13:106667180-106667202 ATGACGATGGGAGCAGGGCCGGG No data
1113096269_1113096280 24 Left 1113096269 13:106667153-106667175 CCTTTCCCTCTGTGGTCACAGAG No data
Right 1113096280 13:106667200-106667222 GGGGAGAGATTTCTTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113096269 Original CRISPR CTCTGTGACCACAGAGGGAA AGG (reversed) Intergenic
No off target data available for this crispr