ID: 1113096373

View in Genome Browser
Species Human (GRCh38)
Location 13:106668326-106668348
Sequence GTGTGAACATAGAGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113096373_1113096378 11 Left 1113096373 13:106668326-106668348 CCCAGCTTCCTCTATGTTCACAC No data
Right 1113096378 13:106668360-106668382 ATAGTACAAGTAGCAAACTGAGG No data
1113096373_1113096379 23 Left 1113096373 13:106668326-106668348 CCCAGCTTCCTCTATGTTCACAC No data
Right 1113096379 13:106668372-106668394 GCAAACTGAGGAAGTGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113096373 Original CRISPR GTGTGAACATAGAGGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr