ID: 1113104325 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:106756825-106756847 |
| Sequence | TTGTCAACACAGATGGCGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1113104320_1113104325 | 22 | Left | 1113104320 | 13:106756780-106756802 | CCTTTTAGATCTTCAGCACCAAT | No data | ||
| Right | 1113104325 | 13:106756825-106756847 | TTGTCAACACAGATGGCGCTGGG | No data | ||||
| 1113104322_1113104325 | 4 | Left | 1113104322 | 13:106756798-106756820 | CCAATTGATGGTCTTTACTTCAA | No data | ||
| Right | 1113104325 | 13:106756825-106756847 | TTGTCAACACAGATGGCGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1113104325 | Original CRISPR | TTGTCAACACAGATGGCGCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||