ID: 1113104325

View in Genome Browser
Species Human (GRCh38)
Location 13:106756825-106756847
Sequence TTGTCAACACAGATGGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113104320_1113104325 22 Left 1113104320 13:106756780-106756802 CCTTTTAGATCTTCAGCACCAAT No data
Right 1113104325 13:106756825-106756847 TTGTCAACACAGATGGCGCTGGG No data
1113104322_1113104325 4 Left 1113104322 13:106756798-106756820 CCAATTGATGGTCTTTACTTCAA No data
Right 1113104325 13:106756825-106756847 TTGTCAACACAGATGGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113104325 Original CRISPR TTGTCAACACAGATGGCGCT GGG Intergenic
No off target data available for this crispr