ID: 1113104750

View in Genome Browser
Species Human (GRCh38)
Location 13:106759953-106759975
Sequence ATCTTGGGGTCCATCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113104742_1113104750 14 Left 1113104742 13:106759916-106759938 CCCAAAGTAAATTTTTTTCTAAG No data
Right 1113104750 13:106759953-106759975 ATCTTGGGGTCCATCTGACCTGG No data
1113104743_1113104750 13 Left 1113104743 13:106759917-106759939 CCAAAGTAAATTTTTTTCTAAGG No data
Right 1113104750 13:106759953-106759975 ATCTTGGGGTCCATCTGACCTGG No data
1113104741_1113104750 15 Left 1113104741 13:106759915-106759937 CCCCAAAGTAAATTTTTTTCTAA No data
Right 1113104750 13:106759953-106759975 ATCTTGGGGTCCATCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113104750 Original CRISPR ATCTTGGGGTCCATCTGACC TGG Intergenic
No off target data available for this crispr