ID: 1113106306

View in Genome Browser
Species Human (GRCh38)
Location 13:106775217-106775239
Sequence AGTGCTGTTGGGGGACAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113106306_1113106315 1 Left 1113106306 13:106775217-106775239 CCCGCTTGTCCCCCAACAGCACT No data
Right 1113106315 13:106775241-106775263 GGGGTGAAAATTCCCAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113106306 Original CRISPR AGTGCTGTTGGGGGACAAGC GGG (reversed) Intergenic
No off target data available for this crispr