ID: 1113110650

View in Genome Browser
Species Human (GRCh38)
Location 13:106819683-106819705
Sequence TTCAAGGATCAGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113110647_1113110650 -1 Left 1113110647 13:106819661-106819683 CCTGGGGGAGATGGGCTTGGCAT No data
Right 1113110650 13:106819683-106819705 TTCAAGGATCAGAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113110650 Original CRISPR TTCAAGGATCAGAGTGAGGA AGG Intergenic
No off target data available for this crispr