ID: 1113112072

View in Genome Browser
Species Human (GRCh38)
Location 13:106834087-106834109
Sequence GGGGGTTAACTGGGTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113112063_1113112072 7 Left 1113112063 13:106834057-106834079 CCCCAGTGTCTGTGAAACAGGAA No data
Right 1113112072 13:106834087-106834109 GGGGGTTAACTGGGTGTTACTGG No data
1113112065_1113112072 5 Left 1113112065 13:106834059-106834081 CCAGTGTCTGTGAAACAGGAATT No data
Right 1113112072 13:106834087-106834109 GGGGGTTAACTGGGTGTTACTGG No data
1113112060_1113112072 9 Left 1113112060 13:106834055-106834077 CCCCCCAGTGTCTGTGAAACAGG No data
Right 1113112072 13:106834087-106834109 GGGGGTTAACTGGGTGTTACTGG No data
1113112062_1113112072 8 Left 1113112062 13:106834056-106834078 CCCCCAGTGTCTGTGAAACAGGA No data
Right 1113112072 13:106834087-106834109 GGGGGTTAACTGGGTGTTACTGG No data
1113112064_1113112072 6 Left 1113112064 13:106834058-106834080 CCCAGTGTCTGTGAAACAGGAAT No data
Right 1113112072 13:106834087-106834109 GGGGGTTAACTGGGTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113112072 Original CRISPR GGGGGTTAACTGGGTGTTAC TGG Intergenic
No off target data available for this crispr