ID: 1113113397 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:106848645-106848667 |
Sequence | GCCTTTCTGCAGAGGGTGGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1113113397_1113113406 | 10 | Left | 1113113397 | 13:106848645-106848667 | CCCCCCACCCTCTGCAGAAAGGC | No data | ||
Right | 1113113406 | 13:106848678-106848700 | CTTTCACAAGCACCACTGAGTGG | No data | ||||
1113113397_1113113407 | 16 | Left | 1113113397 | 13:106848645-106848667 | CCCCCCACCCTCTGCAGAAAGGC | No data | ||
Right | 1113113407 | 13:106848684-106848706 | CAAGCACCACTGAGTGGTATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1113113397 | Original CRISPR | GCCTTTCTGCAGAGGGTGGG GGG (reversed) | Intergenic | ||
No off target data available for this crispr |