ID: 1113113397

View in Genome Browser
Species Human (GRCh38)
Location 13:106848645-106848667
Sequence GCCTTTCTGCAGAGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113113397_1113113406 10 Left 1113113397 13:106848645-106848667 CCCCCCACCCTCTGCAGAAAGGC No data
Right 1113113406 13:106848678-106848700 CTTTCACAAGCACCACTGAGTGG No data
1113113397_1113113407 16 Left 1113113397 13:106848645-106848667 CCCCCCACCCTCTGCAGAAAGGC No data
Right 1113113407 13:106848684-106848706 CAAGCACCACTGAGTGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113113397 Original CRISPR GCCTTTCTGCAGAGGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr