ID: 1113124812

View in Genome Browser
Species Human (GRCh38)
Location 13:106965667-106965689
Sequence CCTGGTCTCCAGCTGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113124812_1113124824 30 Left 1113124812 13:106965667-106965689 CCATTCACCAGCTGGAGACCAGG No data
Right 1113124824 13:106965720-106965742 AGCCAGAGAGCCAAGGGTGTAGG No data
1113124812_1113124820 1 Left 1113124812 13:106965667-106965689 CCATTCACCAGCTGGAGACCAGG No data
Right 1113124820 13:106965691-106965713 AGGCTGGGGTTGTAGTTTGAAGG No data
1113124812_1113124821 23 Left 1113124812 13:106965667-106965689 CCATTCACCAGCTGGAGACCAGG No data
Right 1113124821 13:106965713-106965735 GCCTGAGAGCCAGAGAGCCAAGG No data
1113124812_1113124823 24 Left 1113124812 13:106965667-106965689 CCATTCACCAGCTGGAGACCAGG No data
Right 1113124823 13:106965714-106965736 CCTGAGAGCCAGAGAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113124812 Original CRISPR CCTGGTCTCCAGCTGGTGAA TGG (reversed) Intergenic
No off target data available for this crispr