ID: 1113125271

View in Genome Browser
Species Human (GRCh38)
Location 13:106971402-106971424
Sequence ATCTGTGGCCCATTAAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113125271_1113125277 26 Left 1113125271 13:106971402-106971424 CCAAAATTTAATGGGCCACAGAT No data
Right 1113125277 13:106971451-106971473 GAAGGTGCAGACAGAGATACAGG No data
1113125271_1113125278 29 Left 1113125271 13:106971402-106971424 CCAAAATTTAATGGGCCACAGAT No data
Right 1113125278 13:106971454-106971476 GGTGCAGACAGAGATACAGGAGG No data
1113125271_1113125276 8 Left 1113125271 13:106971402-106971424 CCAAAATTTAATGGGCCACAGAT No data
Right 1113125276 13:106971433-106971455 GATGAATAAAAGTAACTGGAAGG No data
1113125271_1113125275 4 Left 1113125271 13:106971402-106971424 CCAAAATTTAATGGGCCACAGAT No data
Right 1113125275 13:106971429-106971451 GATGGATGAATAAAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113125271 Original CRISPR ATCTGTGGCCCATTAAATTT TGG (reversed) Intergenic
No off target data available for this crispr