ID: 1113125274

View in Genome Browser
Species Human (GRCh38)
Location 13:106971417-106971439
Sequence ATTCATCCATCTTCCATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113125274_1113125276 -7 Left 1113125274 13:106971417-106971439 CCACAGATGGAAGATGGATGAAT No data
Right 1113125276 13:106971433-106971455 GATGAATAAAAGTAACTGGAAGG No data
1113125274_1113125278 14 Left 1113125274 13:106971417-106971439 CCACAGATGGAAGATGGATGAAT No data
Right 1113125278 13:106971454-106971476 GGTGCAGACAGAGATACAGGAGG No data
1113125274_1113125279 23 Left 1113125274 13:106971417-106971439 CCACAGATGGAAGATGGATGAAT No data
Right 1113125279 13:106971463-106971485 AGAGATACAGGAGGAGATGAAGG No data
1113125274_1113125277 11 Left 1113125274 13:106971417-106971439 CCACAGATGGAAGATGGATGAAT No data
Right 1113125277 13:106971451-106971473 GAAGGTGCAGACAGAGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113125274 Original CRISPR ATTCATCCATCTTCCATCTG TGG (reversed) Intergenic
No off target data available for this crispr