ID: 1113125277

View in Genome Browser
Species Human (GRCh38)
Location 13:106971451-106971473
Sequence GAAGGTGCAGACAGAGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113125271_1113125277 26 Left 1113125271 13:106971402-106971424 CCAAAATTTAATGGGCCACAGAT No data
Right 1113125277 13:106971451-106971473 GAAGGTGCAGACAGAGATACAGG No data
1113125274_1113125277 11 Left 1113125274 13:106971417-106971439 CCACAGATGGAAGATGGATGAAT No data
Right 1113125277 13:106971451-106971473 GAAGGTGCAGACAGAGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113125277 Original CRISPR GAAGGTGCAGACAGAGATAC AGG Intergenic
No off target data available for this crispr