ID: 1113125600

View in Genome Browser
Species Human (GRCh38)
Location 13:106975475-106975497
Sequence TCTGATTAGTTTTTATTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113125597_1113125600 16 Left 1113125597 13:106975436-106975458 CCTCGTCAGTGACTATCAAACCA No data
Right 1113125600 13:106975475-106975497 TCTGATTAGTTTTTATTGTCAGG No data
1113125598_1113125600 -4 Left 1113125598 13:106975456-106975478 CCAAGTGAACACAAATTCCTCTG No data
Right 1113125600 13:106975475-106975497 TCTGATTAGTTTTTATTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113125600 Original CRISPR TCTGATTAGTTTTTATTGTC AGG Intergenic
No off target data available for this crispr