ID: 1113128548

View in Genome Browser
Species Human (GRCh38)
Location 13:107008395-107008417
Sequence CTGAATATAAAGATGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113128544_1113128548 24 Left 1113128544 13:107008348-107008370 CCATTTCATAAGCTTTATCTGAG No data
Right 1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113128548 Original CRISPR CTGAATATAAAGATGGATTA TGG Intergenic
No off target data available for this crispr