ID: 1113133043

View in Genome Browser
Species Human (GRCh38)
Location 13:107059787-107059809
Sequence CACAGGGATGGAGCTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2918
Summary {0: 32, 1: 253, 2: 494, 3: 817, 4: 1322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113133043_1113133054 22 Left 1113133043 13:107059787-107059809 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1113133054 13:107059832-107059854 TTCTGGCTGCTTTCACAGGCTGG 0: 27
1: 300
2: 536
3: 1083
4: 1366
1113133043_1113133050 5 Left 1113133043 13:107059787-107059809 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1113133050 13:107059815-107059837 GCAGGGTACAGTCTCCCTTCTGG No data
1113133043_1113133051 18 Left 1113133043 13:107059787-107059809 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1113133051 13:107059828-107059850 TCCCTTCTGGCTGCTTTCACAGG 0: 17
1: 217
2: 577
3: 1017
4: 1501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113133043 Original CRISPR CACAGGGATGGAGCTGCCCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr