ID: 1113135282

View in Genome Browser
Species Human (GRCh38)
Location 13:107082014-107082036
Sequence GGCAAGGAAGGGTATGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113135271_1113135282 2 Left 1113135271 13:107081989-107082011 CCCCAGCAAGGAAGGGTATGGGA No data
Right 1113135282 13:107082014-107082036 GGCAAGGAAGGGTATGGGAAGGG No data
1113135272_1113135282 1 Left 1113135272 13:107081990-107082012 CCCAGCAAGGAAGGGTATGGGAA No data
Right 1113135282 13:107082014-107082036 GGCAAGGAAGGGTATGGGAAGGG No data
1113135273_1113135282 0 Left 1113135273 13:107081991-107082013 CCAGCAAGGAAGGGTATGGGAAG No data
Right 1113135282 13:107082014-107082036 GGCAAGGAAGGGTATGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113135282 Original CRISPR GGCAAGGAAGGGTATGGGAA GGG Intergenic