ID: 1113142908

View in Genome Browser
Species Human (GRCh38)
Location 13:107174754-107174776
Sequence AGGGAGAAGCAGGATGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 776
Summary {0: 1, 1: 0, 2: 5, 3: 95, 4: 675}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113142893_1113142908 30 Left 1113142893 13:107174701-107174723 CCCAGAAAAGTCTATCCAATATC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG 0: 1
1: 0
2: 5
3: 95
4: 675
1113142901_1113142908 4 Left 1113142901 13:107174727-107174749 CCAGGAAGCAGAAGGCCAGGGAG 0: 1
1: 0
2: 11
3: 75
4: 601
Right 1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG 0: 1
1: 0
2: 5
3: 95
4: 675
1113142896_1113142908 15 Left 1113142896 13:107174716-107174738 CCAATATCCATCCAGGAAGCAGA 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG 0: 1
1: 0
2: 5
3: 95
4: 675
1113142898_1113142908 8 Left 1113142898 13:107174723-107174745 CCATCCAGGAAGCAGAAGGCCAG 0: 1
1: 0
2: 5
3: 44
4: 380
Right 1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG 0: 1
1: 0
2: 5
3: 95
4: 675
1113142894_1113142908 29 Left 1113142894 13:107174702-107174724 CCAGAAAAGTCTATCCAATATCC 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG 0: 1
1: 0
2: 5
3: 95
4: 675

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113142908 Original CRISPR AGGGAGAAGCAGGATGTGGC TGG Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901637793 1:10678399-10678421 AGGGAGAGGCAGCAGGTGGGTGG + Intronic
901708218 1:11092813-11092835 AGTGAAAAACAGGTTGTGGCCGG - Intronic
902425604 1:16319133-16319155 TGGGAAAAGCTGGATTTGGCGGG + Intronic
903418443 1:23200969-23200991 TGGGAGAGGCATGGTGTGGCTGG - Intergenic
903539231 1:24087410-24087432 AGGGAGATGCGGGACGTGGGAGG - Intronic
903687875 1:25145855-25145877 AGACAGAATCAGGATGTGACAGG + Intergenic
903775124 1:25788201-25788223 AGAGAAAAGCAGAATCTGGCTGG - Intergenic
904201903 1:28825338-28825360 AGAGAGAGGCAGGGAGTGGCTGG + Intronic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
904349308 1:29894537-29894559 GGCGAGAAGGAGGATGTGCCTGG - Intergenic
904493918 1:30876476-30876498 AGGGATGAGGAGGATGGGGCTGG - Intronic
904642881 1:31943973-31943995 AGGAATCAGCAGGATGTGGTGGG + Intronic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905631065 1:39518807-39518829 AGGGCCCAGCTGGATGTGGCTGG - Intronic
905641489 1:39593006-39593028 AGGTATGAGCAGGATGTGGCTGG - Intergenic
905641873 1:39595541-39595563 ACGGAGAAGGAGGCTGTTGCAGG - Intergenic
905657059 1:39691904-39691926 TGGGAGAGGGAGGAGGTGGCTGG + Intergenic
905666696 1:39767369-39767391 AGGGCCCAGCTGGATGTGGCTGG + Intronic
905675206 1:39819743-39819765 AGTGAGAGGCAGGATGTGTTGGG + Intergenic
905808212 1:40892348-40892370 AGGGAGAAACAGAAAGTGACAGG - Intergenic
905872900 1:41415251-41415273 AGGGAGAAGCAGGAAGGTGGAGG - Intergenic
906174038 1:43753899-43753921 AGGCAGGAGCAGGATCTGGGCGG - Intronic
906175616 1:43769443-43769465 AGGAAGTAGCAGGATGGGGAGGG + Intronic
906656558 1:47552474-47552496 AGAGAGAAGCAGTATGGGTCAGG + Intergenic
907084817 1:51661802-51661824 AGGGAGAGGAAGGATGTCTCAGG + Intronic
907288086 1:53395020-53395042 AGGGAGAAGCGGGCAGGGGCTGG - Intergenic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
907871040 1:58443115-58443137 AAGGAGGAACAGGAAGTGGCAGG - Intronic
909120389 1:71596017-71596039 AGGGAGGGGCAGGGTTTGGCAGG - Intronic
909603068 1:77480922-77480944 GAGGAGAAGCAGGATAGGGCAGG + Intronic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912625615 1:111203198-111203220 GGGAAGGAGCAGGGTGTGGCAGG + Intronic
913564204 1:120055631-120055653 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
913633920 1:120737934-120737956 AGGGAGCAGAAGGGAGTGGCAGG - Intergenic
914284792 1:146214979-146215001 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
914545823 1:148665718-148665740 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
914620740 1:149404948-149404970 AGGGAGCAGAAGGGAGTGGCAGG - Intergenic
915016493 1:152738753-152738775 AGAGAGCAGCAGGAGGTGGGAGG + Intronic
915060547 1:153179654-153179676 AGGAAGAAGTAGTATGTGGGAGG - Intergenic
915095445 1:153459292-153459314 AGGGAGAAGCAGGGAGAGTCGGG + Intronic
915177389 1:154027474-154027496 AGGGAGAATAAGGAAGTGCCAGG - Intronic
915364356 1:155306015-155306037 AGGGATTAGCAGGAGGTGGGGGG + Intergenic
915662697 1:157417059-157417081 AGGGATAAAAAGGATGTGGAGGG - Intergenic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
915953048 1:160202852-160202874 AGCGATAAGCAGGATGGGGAGGG + Intergenic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916443231 1:164847771-164847793 ACAGAGAAGCAGTATGTGTCTGG + Exonic
916807018 1:168269197-168269219 AGGGAGAAGAACGATGCTGCTGG - Intergenic
916984971 1:170181459-170181481 AGGAAGAGGTAGGATGTGGGAGG - Intergenic
917790288 1:178495002-178495024 AGGGAGCTGGAGGAGGTGGCCGG - Intergenic
918346299 1:183610197-183610219 GGGCAGGAGCAGGGTGTGGCTGG + Intergenic
919467322 1:197938067-197938089 AGGGAGAAGCAGCAGGTGCGTGG - Intergenic
919791093 1:201291480-201291502 AGGCAGGTGCAGGGTGTGGCGGG + Intronic
919905084 1:202072862-202072884 AGGGAGATACAGGAGGTGCCTGG + Intergenic
920257588 1:204666011-204666033 AGGAAGAAGCAGGAGTTGGAAGG + Intronic
920284670 1:204870910-204870932 AGGGAAAAGAAGGATCTTGCTGG + Intronic
920413137 1:205778154-205778176 AGTAAGAGGAAGGATGTGGCAGG - Intergenic
920571173 1:207019091-207019113 AGTGGGAAGCATGATCTGGCAGG - Exonic
920666150 1:207964065-207964087 AGGGAGGAGGAGGAGGAGGCAGG + Intergenic
920836269 1:209513899-209513921 AGGGCGAAGGCAGATGTGGCAGG - Intergenic
921485267 1:215708076-215708098 AGTGGGAAGAAGGATGTGGAAGG + Intronic
921900905 1:220449585-220449607 GGTGAGAAGCAGGATCTGGTTGG - Intergenic
922233343 1:223704950-223704972 AGGGAGCGGCAGGAGGGGGCTGG - Intronic
922289292 1:224197305-224197327 CAGGAGAATTAGGATGTGGCTGG + Intergenic
922327156 1:224538630-224538652 AGAGAGAAGGAGGAGGAGGCAGG - Intronic
922722653 1:227906541-227906563 AGGGAGTAGAAGGATGGAGCAGG - Intergenic
922782502 1:228264154-228264176 AGGGAGGTGCAGGCTGAGGCGGG + Exonic
922783024 1:228268568-228268590 AGGGAGGTGCAGGCTGAGGCGGG + Exonic
922783524 1:228271984-228272006 AGGGAGGTGCAGGCTGAGGCAGG + Exonic
922902619 1:229148404-229148426 AGGGAGCAGCTGGAGGTGGGAGG - Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923420977 1:233814632-233814654 AGAGGGAAGCTGGAGGTGGCTGG + Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923629956 1:235643142-235643164 AGGCAGAAGCAGGAAGCAGCAGG - Intronic
924243804 1:242062602-242062624 AGGGAACAGGAGGAGGTGGCAGG + Intergenic
924539901 1:244970768-244970790 AGGGGGAAGGAGGACGGGGCGGG - Exonic
1062941707 10:1426803-1426825 AGGGAGAAGCAGGGTATAGAAGG - Intronic
1063179412 10:3584330-3584352 AGGGACAGGCAGGAGGTGGCAGG - Intergenic
1063616399 10:7604047-7604069 AGGGAGAACCTGGAGGTGCCTGG - Intronic
1063982879 10:11470140-11470162 AGGAAGAAGGAAGACGTGGCGGG + Intronic
1065383375 10:25111687-25111709 AGAGAGAAGCAGGATGAGATGGG - Intergenic
1067172920 10:43922524-43922546 AGGGACCATCAGGAAGTGGCAGG + Intergenic
1067251598 10:44591362-44591384 AAGGAGAAGCAAGGGGTGGCTGG - Intergenic
1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG + Intergenic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1067571709 10:47376621-47376643 GGGGAGAAGGAGGATGGGGTGGG - Intronic
1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG + Intronic
1067912832 10:50364419-50364441 AGTGAAAAGCAGGATGGGGCTGG - Intronic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1069226046 10:65945648-65945670 AGGGAGATGCAGGATGGAACTGG + Intronic
1069518920 10:69102110-69102132 AGGAAGAAACAGGATAAGGCAGG - Intronic
1069595915 10:69670122-69670144 AGGGAGAAGGTTGATGAGGCAGG - Intergenic
1069923478 10:71832042-71832064 GTGGAGAACCAGGATGTGACAGG - Intronic
1070052743 10:72905012-72905034 AGTGAGAAGGGGGAGGTGGCAGG + Intronic
1070155882 10:73835063-73835085 AGGGAGTAGCTGGATTTTGCTGG - Intronic
1070234742 10:74611647-74611669 AGGGGGAGGCAGGAAGTGGGTGG - Intronic
1070932448 10:80271009-80271031 AGGAAGACCCAGAATGTGGCGGG - Intergenic
1070967095 10:80536360-80536382 AGGGAGCAGCAGGAATGGGCCGG - Intergenic
1071797816 10:89025047-89025069 AAGGAGTAGCTGGATATGGCTGG - Intergenic
1072101243 10:92231479-92231501 AGGGAAAAGGAGGAGGTGGGAGG - Intronic
1072124785 10:92436030-92436052 AGGGAAAAGCAAGATCTGGGTGG - Intergenic
1072624843 10:97104667-97104689 AGGGAGAGGGAGGCTGTAGCTGG - Intronic
1072696727 10:97609441-97609463 AGGGTGAGGCAGGATGGGGTAGG - Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1074363792 10:112842282-112842304 TGGGGGAAGCAGGGTGGGGCAGG - Intergenic
1074982699 10:118632609-118632631 TGGGAGAGGCAGGATTTGCCAGG + Intergenic
1075247256 10:120833771-120833793 AGGGAGGAGCAGGATGTTCAGGG + Intergenic
1075316415 10:121457275-121457297 AGAGAGAATCAGGAGGTGCCAGG + Intergenic
1075634491 10:124021018-124021040 AGGGAGGAGGGGGAGGTGGCAGG + Intronic
1075734528 10:124655696-124655718 TGGGAGGAGCTGGCTGTGGCTGG - Intronic
1075922207 10:126223316-126223338 AGGGAGCAGAAGAATGTGACAGG - Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076541381 10:131217250-131217272 AGAGAGAAGCAGGATAGGGGAGG - Intronic
1076603532 10:131674722-131674744 AGGCACAGGCATGATGTGGCAGG - Intergenic
1076624914 10:131815875-131815897 AGGCAGCAGCAGGATGTCACAGG + Intergenic
1076809507 10:132879264-132879286 AGGAAGAATCTGGATGTCGCAGG + Intronic
1077168437 11:1153991-1154013 AGGGAGGAGAAAGCTGTGGCTGG + Intergenic
1077268683 11:1665117-1665139 AGGGAGCAGCAGGGTGTCCCAGG + Intergenic
1077272092 11:1686186-1686208 AGGGAGCAGCAGGGTGTCCCAGG - Intergenic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1078108494 11:8373438-8373460 AGGCAGGGGCAGGATGTAGCAGG + Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078538696 11:12196288-12196310 GGGGAGAAGCAGGTTTTTGCAGG + Intronic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1080720663 11:34845280-34845302 AGAGAGAAGCGGGAGGTGCCAGG - Intergenic
1080804339 11:35638499-35638521 AGGGAGAGGCAGGAACTGGGAGG + Intergenic
1080820654 11:35802952-35802974 AGGGAAAGGCAGGAGGAGGCAGG + Intronic
1081092377 11:38888350-38888372 ATGGAGAGGCAAGAAGTGGCGGG - Intergenic
1081529366 11:43947459-43947481 AAGGAGAGGCAGGCTGGGGCCGG + Intergenic
1081540547 11:44031574-44031596 AGGGAGCAGGAGGAGGTGGGAGG + Intergenic
1081668746 11:44931747-44931769 AGGGAGAAACAGGGTTTAGCTGG + Exonic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083737043 11:64687358-64687380 AGAGAGAAGCAGGCTGTGTGTGG - Intronic
1084683081 11:70678470-70678492 AGGGAGAGGCAGGGAGAGGCAGG - Intronic
1084899387 11:72298319-72298341 AGGGACAAGCAGCAAGTGCCAGG - Intronic
1085312923 11:75526445-75526467 AGGGAGAAGCAAGGTGTCGGTGG - Intergenic
1085541479 11:77274488-77274510 AGAGAGAAGGAGGAGGTGCCAGG - Intronic
1085806117 11:79637928-79637950 AAAGAGAAGGAGGATGTGCCAGG + Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086453358 11:86938551-86938573 AGGAAGAGGAATGATGTGGCTGG + Intronic
1087161098 11:94948863-94948885 AGTGAGAGGCAAGATGAGGCAGG - Intergenic
1087235030 11:95708623-95708645 AAGGAGAAGCATGATCTAGCCGG + Intergenic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1089177842 11:116561207-116561229 AGGTAGAGGGAGGATGGGGCAGG - Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089537712 11:119170837-119170859 GGGGAGAGGCAAGACGTGGCAGG + Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG + Intergenic
1089775025 11:120830049-120830071 AGGGAGCTGGAGGCTGTGGCAGG - Intronic
1090444039 11:126748246-126748268 AGGGAGTAAAAGGAAGTGGCTGG - Intronic
1090818629 11:130320188-130320210 AGAGAGAAGAAGGCAGTGGCTGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091560077 12:1605531-1605553 TGGGAAAAGCGGGGTGTGGCCGG + Intronic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092834013 12:12471088-12471110 CAGGAAATGCAGGATGTGGCCGG - Intergenic
1093089826 12:14908645-14908667 AGCAAAAAGGAGGATGTGGCAGG + Intergenic
1094268838 12:28588937-28588959 AGGGAGAGCCAGGAGGTGGGTGG + Intergenic
1094636070 12:32227850-32227872 AGGGTGAAGCGGGAGATGGCTGG - Intronic
1095307281 12:40653010-40653032 TAGGAGAAGCAGGTTGGGGCAGG - Intergenic
1096694331 12:53339058-53339080 AGGGAGAGGCGCCATGTGGCAGG + Intronic
1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG + Intergenic
1097144529 12:56930804-56930826 AGGGAGAAGTATGATGGGGAAGG - Intronic
1097176951 12:57148838-57148860 ATGGGGAAGAAGGAGGTGGCTGG + Intronic
1097243304 12:57591143-57591165 AGGGCGAGGCAGGACGGGGCGGG - Intergenic
1097813652 12:64046651-64046673 GGGGAGAAGCAGGCTGAAGCGGG + Intronic
1101365217 12:104064500-104064522 AGGGAGCAGCCGGTTGAGGCGGG + Exonic
1101494397 12:105239822-105239844 GGGGAGAAGCAGGTTGTTGGTGG + Intronic
1101646962 12:106640254-106640276 TGGCAGAGGCAGGAAGTGGCTGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1103290615 12:119843197-119843219 AGAGAGAAACAGTAAGTGGCTGG + Intronic
1103341094 12:120221562-120221584 AGGGAGGAGAAGGATGAGGGAGG + Intronic
1103825101 12:123731794-123731816 GAGGAGAGGGAGGATGTGGCTGG - Intronic
1104106292 12:125662815-125662837 AGGGAGAAGTTTGAAGTGGCAGG + Intergenic
1104647569 12:130508279-130508301 AGGGAGAGGCAAGATCTGGCAGG - Intronic
1104701409 12:130907290-130907312 AGACAGAATGAGGATGTGGCTGG - Intergenic
1105814293 13:24020106-24020128 AGGGAGAAGCTGTATGCAGCTGG - Intronic
1106353816 13:28959642-28959664 AGGGAGAAAGAGGAGGTGCCAGG + Intronic
1109115073 13:58371715-58371737 AGTGAGAAGCTGGAGGTGGCTGG + Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110772501 13:79366070-79366092 AGGGTGGAGCAGGAGGAGGCTGG + Exonic
1112654573 13:101436655-101436677 AGGAAGAAGCAAGATTGGGCAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1114483786 14:23050984-23051006 GGGTAGGAGCAGGATTTGGCAGG + Intronic
1114522481 14:23347951-23347973 AAGGAAAAGGAGGATGTTGCAGG + Exonic
1114616481 14:24071444-24071466 AGGGAGAAGAGGGAAGGGGCAGG - Intronic
1117182260 14:53202791-53202813 AGGGAGGATCAGGAGGTGGGTGG - Intergenic
1117579582 14:57138710-57138732 AGGGGGAAGGAGGATGGGTCAGG + Intergenic
1117852584 14:59990868-59990890 TGGGAGAAGAAGGAAGTGTCAGG - Intronic
1117998363 14:61499498-61499520 AGGGAGGAGCAAGATGTGAGGGG - Intronic
1119220285 14:72900960-72900982 AGGGAGAAGGGGGCTGGGGCTGG - Intergenic
1119519764 14:75277344-75277366 GGGGCGAGGCAGGATGAGGCCGG - Intergenic
1119881918 14:78106418-78106440 AGGGAGAGGGAAGATGTGGTTGG + Intergenic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1120464439 14:84838764-84838786 AAAGAGAAGCAGCATGTGGTTGG + Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1120985655 14:90332106-90332128 AGGGCAAAGCAGGGTGGGGCGGG + Exonic
1121001100 14:90452606-90452628 AAAGAGAAACAGGATGTGACTGG - Intergenic
1122268618 14:100558329-100558351 AGGGAGAGGCAGCATGTGCCTGG - Intronic
1122370747 14:101227714-101227736 AGGGAGAAGCAGGTCGGGGCAGG + Intergenic
1122381856 14:101313555-101313577 AGGGAGAAGCAGGTCGGGGCAGG - Intergenic
1122634900 14:103125231-103125253 AGGGGGAAGCAGGCAGGGGCTGG - Intronic
1123215572 14:106806314-106806336 AGGGACAGACAGGGTGTGGCAGG + Intergenic
1123826362 15:24086287-24086309 AAGGTGAAGCAGTTTGTGGCAGG - Intergenic
1124004560 15:25785579-25785601 AGGCAGAAGCAGTGAGTGGCAGG + Intronic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1127647299 15:60971486-60971508 AGGGAAAAGCACGATATGTCTGG - Intronic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1128063547 15:64750137-64750159 AGGGAGGACCAGGAGCTGGCTGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128502186 15:68234284-68234306 AGAGATAAGCAGAATGTGGGTGG + Intronic
1128546471 15:68572015-68572037 AGGGATAAGCAGGACCTGGGGGG + Intergenic
1129608789 15:77037545-77037567 GGGGTGCAGGAGGATGTGGCAGG + Intergenic
1129665294 15:77576226-77576248 AGGGAGGAGCAGGGGGAGGCTGG + Intergenic
1129853758 15:78810552-78810574 AGGGAGAGGCAGGAAGTGCAAGG + Intronic
1129888435 15:79055052-79055074 AGGGAGGAGAAGGCTGTGGTGGG + Intronic
1131364547 15:91827344-91827366 AGGAACAAACAGGACGTGGCAGG - Intergenic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131390542 15:92044431-92044453 TGAGAGAATGAGGATGTGGCAGG - Intronic
1131553102 15:93374750-93374772 AGGCAGAGGCAGGATGGGGTTGG + Intergenic
1131640061 15:94283058-94283080 AGGCAGAAGAAGGCTGTGGGTGG + Intronic
1132108840 15:99087482-99087504 AGGGAGCAGCAGAATGTTTCCGG - Intergenic
1132389039 15:101425331-101425353 AGGGAGAACCAGGAGGAAGCGGG - Intronic
1132412831 15:101597556-101597578 AGGGAGGATCAGGAGGTGGGTGG + Intergenic
1132664741 16:1076247-1076269 AGGGAGAGGGAGGGGGTGGCAGG - Intergenic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1132906777 16:2286541-2286563 ATGGTGGAGGAGGATGTGGCAGG + Intronic
1132996963 16:2828521-2828543 AGGCAGAAACAGGAGGTGGTTGG + Intergenic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133389776 16:5400387-5400409 AGAGAGAAGCAAGCAGTGGCCGG - Intergenic
1133725096 16:8530128-8530150 AGGCAAAAAAAGGATGTGGCAGG - Intergenic
1134122780 16:11596649-11596671 GGGGAGAGGGAGGATGTGGAGGG + Intronic
1136540758 16:30926567-30926589 AGGGGGACGCAGGATGCAGCTGG - Intronic
1136625332 16:31458776-31458798 AGGGAGAATCCGGACGGGGCGGG - Intronic
1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG + Intergenic
1137433139 16:48434508-48434530 GGGGAGGAGCCAGATGTGGCTGG - Intronic
1137608226 16:49801181-49801203 ACAGAGAGGCAGGCTGTGGCAGG - Intronic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1137840629 16:51637480-51637502 AGGGAGAAGAAGGAGGGGGGAGG + Intergenic
1138493097 16:57388368-57388390 AGAGAGAAGGAGGCTGAGGCGGG - Intergenic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139064812 16:63299887-63299909 AGTGAAAAAAAGGATGTGGCCGG + Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139306834 16:65993759-65993781 AGGGAGAGGCAGCATGAGCCTGG - Intergenic
1139380858 16:66529787-66529809 AGGGAGAGGGAGGAAGTGCCTGG - Intronic
1139392449 16:66613393-66613415 AGGAAGAAGGAGGGTTTGGCTGG - Exonic
1139432260 16:66917579-66917601 AAGGAGAAGCAGGACTTTGCGGG + Intronic
1139805032 16:69557693-69557715 AGAGAGAAGGAGGAGGTGCCAGG + Intergenic
1140474813 16:75234573-75234595 GGGGAGCAGCAGGAGGTGGTGGG - Intronic
1141635119 16:85310516-85310538 GGGGAGAAGGAGGAGGTGGGAGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1142099650 16:88264570-88264592 AGGGGGGAGGAGGATGTGGGAGG - Intergenic
1142524923 17:533433-533455 AGGGCTTAGCAGGATGAGGCTGG - Intronic
1142675714 17:1511992-1512014 AAGGACTAGCAGGAGGTGGCTGG + Intronic
1142808779 17:2385670-2385692 CGGGAGAAGCAGGGTGTTGAGGG + Exonic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143275226 17:5705384-5705406 AAGAAGACGCAGGAGGTGGCAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143779176 17:9220508-9220530 AGAGCCAAGCAGGATGTGGAGGG - Intronic
1144686879 17:17231968-17231990 AGGGAGACCCTGGGTGTGGCTGG + Intronic
1144712266 17:17409616-17409638 AGGAAGAAGGAGGAGTTGGCCGG - Intergenic
1144764109 17:17723690-17723712 AGGGAGGAGGAGGAGGGGGCAGG - Intronic
1144944395 17:18962338-18962360 GGGAAGAGGCAGGATGTGTCTGG + Intronic
1145145584 17:20476890-20476912 AGGGAGAAACAGGAAGCCGCAGG + Intergenic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146846920 17:36187965-36187987 AGAGAGAAGCAGGACTTGGAGGG - Intronic
1146953503 17:36922503-36922525 AGGGAGCAGCTGTATGTGCCAGG - Intergenic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147253472 17:39167192-39167214 AGGGAGAAGCCCCATGTGGCTGG - Intronic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1147403452 17:40194492-40194514 AGGGAGTAGCAGCAGGTGGGAGG + Exonic
1147578196 17:41614406-41614428 AGGCAGAAGCAGGCTGTCTCTGG - Intronic
1148073617 17:44922704-44922726 TGGAAGAGGCAGGATGAGGCAGG + Intergenic
1148185668 17:45641714-45641736 AAGGCCAAGCAGCATGTGGCAGG + Intergenic
1148191426 17:45681328-45681350 AGGGTGGAGCAGGATGAGGGTGG - Intergenic
1148741700 17:49896977-49896999 AGGGAGAAGCAGGACAGAGCTGG - Intergenic
1148784775 17:50140713-50140735 GGAGAGAAACAGGATGTGGGTGG - Intronic
1149273165 17:55004726-55004748 AGGGGGAAGGAGGAGGAGGCGGG + Intronic
1149367507 17:55960587-55960609 AGACAGAAGCAGGAGGGGGCAGG + Intergenic
1149600684 17:57891246-57891268 GGGGAGAAGCAGGTTGGGGTCGG - Intronic
1149999686 17:61425953-61425975 AGGGAGAGGAAGGATGGGACAGG + Intergenic
1150702273 17:67458183-67458205 AGGAGGAAGCAGGAGGAGGCAGG - Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1151243433 17:72776004-72776026 AGGGAGAGGGAACATGTGGCAGG - Intronic
1151815392 17:76469163-76469185 ACGGAGATGAAGGCTGTGGCAGG - Exonic
1152537635 17:80959876-80959898 AGGGAGAGGCAGGGGCTGGCAGG - Intronic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1153891902 18:9524770-9524792 ATGCAGAGGCAGGCTGTGGCAGG - Intronic
1154261935 18:12842633-12842655 AGGGACATGAAGAATGTGGCTGG + Intronic
1154349904 18:13574265-13574287 GGGAAAAAGCAGAATGTGGCTGG + Intronic
1155248741 18:23935961-23935983 AGCTGGAGGCAGGATGTGGCTGG + Intronic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156490214 18:37491647-37491669 AGGGAGAAGGAGTGTGTGGCAGG + Intronic
1156789976 18:40959795-40959817 AGAGTGAAGCAGGAATTGGCCGG - Intergenic
1156950852 18:42895920-42895942 AGGAAGATGGGGGATGTGGCAGG + Intronic
1157442843 18:47723512-47723534 ATGGAGAAGGAGGATGGAGCTGG - Intergenic
1157581305 18:48775745-48775767 AGGAAGAGGCAGGATCTGGGTGG + Intronic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1158591917 18:58785182-58785204 AGGGAGAAGTGGGATCAGGCTGG - Intergenic
1160034342 18:75286917-75286939 AAGGAGAAGCCGCCTGTGGCTGG + Exonic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160726725 19:620829-620851 AGGGAGAAGCAGGACGGGCAGGG + Intronic
1160760393 19:781260-781282 AGGAAAAAGCAGGATGAAGCGGG - Intergenic
1160900178 19:1424079-1424101 AGGAAGAGGGAGGAGGTGGCGGG - Intronic
1160918354 19:1508226-1508248 AGGGAGGAGCAGGACCTGGCGGG + Intronic
1161074873 19:2280748-2280770 AGGGAGCGGCAGGAGGTTGCCGG - Intronic
1161112678 19:2478937-2478959 TGGGAGAAGTAGGAGGTGGCTGG - Intergenic
1161305710 19:3566417-3566439 AGGGAGAGTCAGGGTGTGGTTGG - Intronic
1161793665 19:6374784-6374806 AGGAAGAAACAGGCTGTGACTGG - Intronic
1161907638 19:7169049-7169071 AGGGAGAGTCAGGTTTTGGCTGG - Intronic
1162494789 19:11017661-11017683 AGGGAGAAGCCGGAGGTGTGCGG - Intronic
1162916477 19:13877062-13877084 AGGGAGGAGCAGGCTGTGGGAGG - Intronic
1163260791 19:16188686-16188708 AGGGAGACACAGGCTTTGGCTGG + Intronic
1163428011 19:17249803-17249825 AGGGAGATGCTGGGTTTGGCTGG - Exonic
1164305927 19:24003856-24003878 AGGGAGGAGCAGCATTTGGCCGG + Intergenic
1164597296 19:29538737-29538759 AGAGAGAGGGAGGATGTGCCAGG + Intronic
1164846052 19:31433371-31433393 AGGAAGATGCAGGAGGTTGCTGG + Intergenic
1164870569 19:31640081-31640103 AGGGAGAAGACGGATCTGGCTGG + Intergenic
1164932802 19:32188186-32188208 AAGGATGAGTAGGATGTGGCAGG - Intergenic
1165081624 19:33310240-33310262 GGGAAGAAGCAGGATGTGAATGG - Intergenic
1165117697 19:33538844-33538866 AGGTGGAGCCAGGATGTGGCAGG - Intergenic
1165550614 19:36581678-36581700 AGGGAGAGGGAGGAGGTGCCAGG - Intronic
1165710177 19:38005355-38005377 AGGGATCTGCAGGATGAGGCGGG - Intronic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165856815 19:38883878-38883900 AGGGAGGAGAAGCAAGTGGCAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166586488 19:43953603-43953625 AGGTAGTTTCAGGATGTGGCTGG - Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1167240073 19:48338420-48338442 GGGGAGGAGCAGGAGGTGACAGG - Intronic
1167655257 19:50759519-50759541 AAGAAGAGGCAGGATTTGGCAGG - Intergenic
1167657059 19:50771750-50771772 AAGAAGAGGCAGGATTTGGCAGG - Intergenic
1167831413 19:52025890-52025912 AGGAAGAAGAAGGAGGTTGCTGG - Exonic
1168294170 19:55370541-55370563 AGGGTGAGTCAGGATGTGTCAGG - Intergenic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
1168418264 19:56183252-56183274 AGGGGGAACAAGGAAGTGGCAGG + Intronic
1168492436 19:56821961-56821983 TGGGAGCAGAAGGATGAGGCAGG - Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925271148 2:2608511-2608533 AGGCAGGAGCAGGATATGGGCGG - Intergenic
925370349 2:3340322-3340344 AAGGAGAAGCCAGATATGGCCGG + Intronic
925380915 2:3425402-3425424 TGGGGGAAGCAGGATGTAACTGG - Intronic
926004895 2:9366002-9366024 AGTGAGAAGCAGGAGATGCCAGG + Intronic
926395284 2:12435005-12435027 AGGGAGAAGCAGGACATGATAGG - Intergenic
926983848 2:18599588-18599610 AGAGAGAAACAGGATGTGACAGG - Intergenic
927430587 2:23023409-23023431 AGGGGGAGGCAAGGTGTGGCTGG - Intergenic
927705634 2:25294873-25294895 AGGGAGGAGGAGGAGGGGGCTGG - Intronic
928310399 2:30204923-30204945 AGGGAAAAGCAACATGTGCCTGG - Intergenic
929250079 2:39743641-39743663 AGGGAGAAGGGGGAGGTGCCAGG - Intronic
929669055 2:43854767-43854789 AGGGAGATCCTGGCTGTGGCTGG + Intronic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
930845653 2:55900712-55900734 ATGGGGAAACTGGATGTGGCTGG + Intronic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
931195351 2:60047508-60047530 AGGGAGATACAGAGTGTGGCTGG + Intergenic
931721896 2:65072697-65072719 AGGGGGAAGCTGGCTTTGGCTGG - Exonic
933723051 2:85410347-85410369 AGTGAGAAGCCGGGTGGGGCAGG - Exonic
933938754 2:87228102-87228124 AGAGAGAAGCAGGAGGCGGCTGG - Intergenic
934566231 2:95343090-95343112 AGGGAGAACAATGCTGTGGCTGG + Intronic
934754067 2:96813177-96813199 AGAGAGAAGCAGGAATTAGCCGG + Intergenic
935208841 2:100921137-100921159 AGGGAGCTGTAGGAAGTGGCAGG + Intronic
936022464 2:109005366-109005388 AGGGAGATCCAGGCTGTGGAAGG - Intergenic
936152999 2:110031880-110031902 AGGGAGAGGGAGGGTGGGGCTGG + Intergenic
936191681 2:110339532-110339554 AGGGAGAGGGAGGGTGGGGCTGG - Intergenic
936354382 2:111737673-111737695 AGAGAGAAGCAGGAGGCGGCTGG + Intergenic
936462815 2:112724692-112724714 GGGGAGAGGCAGGCTGTGGTGGG + Intronic
936619730 2:114082916-114082938 AGAGTGAGGCAGGATTTGGCTGG - Intergenic
937039223 2:118808011-118808033 AGGGAGAGGGGGGAGGTGGCAGG + Intergenic
937217377 2:120321294-120321316 AGGGAGAAGGAGGAGGAGGGAGG - Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938119610 2:128624369-128624391 AGGGAGGGGCTGGATGTGCCCGG - Intergenic
938540798 2:132282138-132282160 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
938652982 2:133402668-133402690 AGAGAGAAGGAGGAAGTGCCAGG - Intronic
938935233 2:136121738-136121760 AGCGAGCAACAGGAGGTGGCAGG - Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
941482104 2:166028954-166028976 TGGGACAAGAAGGATGTGGTGGG + Intronic
942686955 2:178542836-178542858 AGGAAGCAGCAGGAGGTGGACGG + Exonic
943947765 2:194090119-194090141 ACGGATCAGCAGGATGTGGGTGG - Intergenic
944090509 2:195904700-195904722 AGGGAGCAGCAAGGTGTGGCAGG + Intronic
944834959 2:203570223-203570245 AGTGAGAAGATGGCTGTGGCTGG - Intergenic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
946172991 2:217906300-217906322 GGGGAGAAGAAGGATGGGGCTGG - Intronic
947054071 2:226080449-226080471 AAGGGGAAGAAGGCTGTGGCAGG + Intergenic
947101088 2:226621913-226621935 AGGGAGAGGCATGGTGTGACAGG - Intergenic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947572793 2:231249157-231249179 AGACAGCAGCAGGATGGGGCAGG - Intronic
947612239 2:231531297-231531319 GGGGAGCAGGAGGCTGTGGCTGG - Intergenic
947722539 2:232378615-232378637 AGGGAGTGGCAGGGTGTGGCTGG - Exonic
947726876 2:232406708-232406730 AGGGAGTGGCAGGGTGTGGCTGG - Intergenic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
1168797446 20:620852-620874 AGGGAGGGTCAGGCTGTGGCAGG + Intergenic
1169147064 20:3259681-3259703 GGGGAGCAACAGGGTGTGGCGGG - Intronic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1170401733 20:15992630-15992652 AGGGCGATACAGGATGTAGCCGG - Intronic
1170434840 20:16315666-16315688 AGCAGGAAGCAGGATGGGGCTGG + Intronic
1170830314 20:19833924-19833946 GGGGACAAGCAGGAGGGGGCAGG - Intergenic
1171138460 20:22719555-22719577 AGGGAAAAGCAGGGTGGGGTGGG + Intergenic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1171869706 20:30515139-30515161 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
1171870493 20:30520917-30520939 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1172035770 20:32010047-32010069 AGGGGGAAACAGGCTGTGACAGG + Intergenic
1172949048 20:38710582-38710604 AGCCAGCAGCTGGATGTGGCTGG + Intergenic
1173142449 20:40495959-40495981 AGGGTGAAGTAGGGTCTGGCTGG - Intergenic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1173997053 20:47346439-47346461 GGGGAGCAGCAGGAGGAGGCTGG - Intronic
1174215530 20:48913297-48913319 AGGCAGAAGCATCATTTGGCTGG - Intergenic
1174511921 20:51059952-51059974 TGAGAGAAGCAGGATGGAGCAGG + Intergenic
1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG + Intergenic
1175841904 20:62033288-62033310 AGGCAGAAGAGGGAGGTGGCAGG + Intronic
1175977870 20:62721955-62721977 AGTGAGAAGCAGGAGGTGTCAGG - Intronic
1176031684 20:63015971-63015993 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031687 20:63015981-63016003 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031690 20:63015991-63016013 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031693 20:63016001-63016023 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031696 20:63016011-63016033 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1179970619 21:44835276-44835298 AGGGAGTGTCCGGATGTGGCCGG - Intergenic
1180071299 21:45436954-45436976 GGGGAGCAGCTGGCTGTGGCAGG + Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1181021712 22:20106966-20106988 AGGGAGCAGCAGGATTCTGCTGG - Intronic
1181572234 22:23773834-23773856 AGGGAGCAGGAGGGTGTGACAGG + Intronic
1181622454 22:24100421-24100443 AGGGAGAAGCAGCAGATTGCTGG + Intronic
1182326423 22:29516688-29516710 AGGGAGAAGGAGGAGATGTCCGG + Intronic
1182330645 22:29549419-29549441 AGTGTGGAGCAGGATGTGGGTGG - Intronic
1183240534 22:36654641-36654663 AGTCAGAAGCCGGATTTGGCAGG + Intronic
1183401114 22:37605238-37605260 AGGGACATGCAGGATCTGACTGG + Intergenic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1184141120 22:42577883-42577905 AAGGAGAAGCTGGAGCTGGCTGG - Intergenic
1184285227 22:43466862-43466884 AGGGACAATCAGGAGGTGGAGGG - Intronic
1184341468 22:43888340-43888362 AGGAAGAGCCAGGATGTGGATGG + Intronic
1184783173 22:46659156-46659178 AGGCCGAAGCAGGAGGTTGCTGG - Intronic
1184892670 22:47389410-47389432 AGGCAGGAGCAGAACGTGGCTGG - Intergenic
1185273319 22:49938439-49938461 ATGGAGAAGGCGGATGGGGCAGG + Intergenic
1185419161 22:50725825-50725847 AGGGAGGAGAAGGATGGGCCTGG - Intergenic
949978231 3:9480204-9480226 AGGTAGAATCAGGTTGTGGTTGG - Intergenic
950548401 3:13652585-13652607 AGGGAGGAGCAGGCTGGGGGTGG + Intergenic
950768349 3:15290914-15290936 AGGCAGAAACAGGAAGTGGCTGG + Intronic
951856300 3:27200895-27200917 AGTGGGAAGCACCATGTGGCTGG + Intronic
951880563 3:27477714-27477736 AGGCTGAGGCAGGATGAGGCGGG - Intronic
952160615 3:30689619-30689641 AGGGGGAACCAGGCTGTGGTGGG + Intronic
953004499 3:38965548-38965570 AGAGAAGAGCAAGATGTGGCTGG - Intergenic
953038931 3:39237786-39237808 GGAGGGAAGCAGGATGGGGCAGG - Intergenic
953170139 3:40499778-40499800 AAGAAGAAACAGGATGTGCCTGG - Intergenic
953410983 3:42690446-42690468 AGGGAGAAGAAGGATAGAGCAGG + Intronic
953660551 3:44888503-44888525 AGGGAGAGGAAGGAAGAGGCCGG - Intronic
953886989 3:46719706-46719728 AGGGAGAAGCAGCCTCTGGGAGG + Exonic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
954007713 3:47605473-47605495 TGGAAGAAGCCAGATGTGGCCGG + Intronic
954322297 3:49840424-49840446 GGGGAGCAGCAGGAGGGGGCAGG - Intronic
954415905 3:50393246-50393268 AGGGAGGAGCAGGGTGGGGGTGG - Intronic
954699422 3:52443563-52443585 TGGGGGCAGTAGGATGTGGCAGG + Intronic
954807202 3:53227397-53227419 AGGCAGGAGCAAGATGGGGCTGG - Intronic
955808404 3:62760585-62760607 AGGAGGAGGCAGGAGGTGGCAGG - Intronic
955946912 3:64204220-64204242 AGAAAGAAGCAGGATATGGGAGG + Intronic
955950188 3:64235942-64235964 GGGGAGGGGCAGTATGTGGCAGG + Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
959239768 3:103775509-103775531 AGGAAGAAGGAGGATGTAGAAGG - Intergenic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
960739282 3:120815109-120815131 TGGAAGAAGCAGGATTGGGCAGG - Intergenic
960763476 3:121098355-121098377 AGAGAGAGGCAGGAGGTGCCAGG + Intronic
961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG + Intergenic
961581547 3:127887454-127887476 ACAAAGAAGGAGGATGTGGCTGG + Intergenic
962845967 3:139274164-139274186 AGGGAGGAGCTGCATGGGGCTGG - Intronic
962973888 3:140429480-140429502 AGGAAGGAGCACAATGTGGCTGG + Intronic
963814337 3:149813000-149813022 AGGGAAGAGCAGGGTGGGGCAGG - Exonic
963923687 3:150929325-150929347 AGGGAGCAGAAGCAGGTGGCAGG + Intronic
964504504 3:157383990-157384012 AGGTAAAAGCTGGATGTGGGGGG + Intronic
967224101 3:187274855-187274877 AGGGAGAAGAAAGAGCTGGCAGG + Intronic
967859321 3:194139732-194139754 TGGGAGGAGAAGGATGAGGCGGG + Intergenic
968529559 4:1083789-1083811 GGGGAGCTGCAGGTTGTGGCTGG + Intronic
968615053 4:1573949-1573971 AGGGAGGAGCTGGATGAGGGAGG - Intergenic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
969251101 4:5969435-5969457 AGAGGAAAGCAGGAGGTGGCAGG + Intronic
969331859 4:6478261-6478283 GGCGAGAAGCAGGATGTGTGTGG - Intronic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
970228826 4:13887919-13887941 AGGGAGAAGGAGGAAATGGATGG - Intergenic
970232058 4:13921044-13921066 AGGGCGAGTGAGGATGTGGCTGG - Intergenic
970627339 4:17902148-17902170 AGAGAGACACAAGATGTGGCTGG + Intronic
971017763 4:22506143-22506165 GGGGAGAAGCAGGAAGGTGCTGG + Intronic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
972561489 4:40232713-40232735 AGTGGGGAGCAGGAAGTGGCCGG - Intronic
972872668 4:43319736-43319758 AGGGAAAAGCAGGACAGGGCAGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973594960 4:52478655-52478677 AGGGATAAGGAGGAGGTGCCGGG - Intergenic
975650943 4:76592229-76592251 TGGGTGGAGCAGAATGTGGCGGG + Intronic
976413948 4:84749778-84749800 AGGGAAAAGCAGGGGGTGTCAGG - Intronic
976482673 4:85563035-85563057 TGAGGGAAGCAGGATGGGGCAGG + Intronic
976550789 4:86392778-86392800 AGGGATAAGGAGGAAGTGGCTGG + Intronic
978379093 4:108107785-108107807 AGTGAGAAGCAGCATGTTGGGGG - Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982702430 4:158671741-158671763 AGGGAGAAGAGGGAGGCGGCGGG + Exonic
983999748 4:174225605-174225627 AGGCAGAAGCCGTATCTGGCAGG - Intergenic
984648033 4:182240679-182240701 AGGGAAAGGCAGGATCTAGCAGG + Intronic
984809485 4:183782208-183782230 AGGCAGAAGAGAGATGTGGCAGG - Intergenic
985648746 5:1097702-1097724 ACAGAAAAGCAGGGTGTGGCTGG + Intronic
985756189 5:1719930-1719952 CAGCAGGAGCAGGATGTGGCAGG + Intergenic
986286072 5:6360085-6360107 AGGAGGAGGCAGGATGTGGCAGG + Intergenic
986386746 5:7242317-7242339 AAGGACAAGCACGACGTGGCAGG + Intergenic
986520053 5:8605582-8605604 GGGCAGTAGCAGGATGGGGCAGG - Intergenic
987029516 5:13963035-13963057 AGGGAGAGGGAGAAGGTGGCTGG - Intergenic
987292358 5:16520858-16520880 AAAGAGGAGCAGGAGGTGGCAGG + Intronic
987955539 5:24735175-24735197 AGGGAGAATCCGGATGTGGTAGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
989272589 5:39550485-39550507 AGGGAGTAGCAGAAAGTGTCAGG + Intergenic
991707211 5:69369543-69369565 AGGGAGGAGCCGGAAGGGGCGGG + Exonic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992198371 5:74361577-74361599 AGGCAGAGGAGGGATGTGGCGGG + Intergenic
992366852 5:76101066-76101088 AGGGAGATGCAGGATGTATGAGG + Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992809210 5:80370148-80370170 AGGTATTAGCAGCATGTGGCAGG + Intergenic
992898682 5:81270577-81270599 AGGGAGAACCAGGCAGTGGGCGG - Intergenic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
994148753 5:96423821-96423843 ATGGAGAATCAGGATTTGGGGGG - Intronic
994347251 5:98701120-98701142 AGGGAGAATCAGGTGGTGGGTGG - Intergenic
994945183 5:106378812-106378834 AGGGAAAAGGAGGAGGTGCCAGG - Intergenic
995229576 5:109743921-109743943 AGTGTGAAGCAGGAAGTGACTGG - Intronic
995777050 5:115734899-115734921 AAGGAGAAAAAGGATGTGCCAGG + Intergenic
996590895 5:125146931-125146953 AGGGAGAAGCAGGGAGAAGCAGG - Intergenic
997113205 5:131097859-131097881 AGGGAGAAAGATGATGTGGTAGG - Intergenic
997248426 5:132370549-132370571 AGGGAGGAGCACACTGTGGCTGG - Intronic
997270011 5:132528481-132528503 AGGGAGATTCAGGAAGTGCCAGG - Intergenic
997280498 5:132641024-132641046 GGGGAGCTGCAGGATGTGTCTGG - Intronic
997361410 5:133297636-133297658 AGGGAGCAGGAGGCTGTGGCTGG - Intronic
997411259 5:133692739-133692761 AGGGAGCAGCAGGAAGTGAGAGG - Intergenic
997632265 5:135377837-135377859 TGGGAGAAGCAGGATTAAGCAGG - Intronic
999088404 5:148913315-148913337 AGGATGAAGCAGCATGAGGCAGG - Intergenic
999625562 5:153517020-153517042 AGAGAGAGGCAGGAGGTGGGAGG + Intronic
1000171326 5:158705731-158705753 AGGAAGGAGCAGGAAGTGGTTGG - Intronic
1001240619 5:170067267-170067289 AGGCAGAAGCAGGAAGTGTCAGG - Intronic
1001240734 5:170067907-170067929 AGGGAGGGGCAGGAAGGGGCAGG + Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001318904 5:170664121-170664143 GGGGAGTTGCAGGATGAGGCTGG - Intronic
1001553447 5:172620647-172620669 GGGGAGTGGCAGGCTGTGGCCGG - Intergenic
1002512430 5:179731694-179731716 AAGGTTAAGCAGGAGGTGGCAGG - Intergenic
1002521557 5:179795574-179795596 AGGGAGAAGTAGGCTGGGGGAGG - Exonic
1002568683 5:180128216-180128238 AGGGAGAGGGAGGCTGGGGCGGG - Intronic
1002612927 5:180433213-180433235 AGAGTGAAGCAGGAAGTGGCAGG - Intergenic
1002658655 5:180774227-180774249 AGAGAGAGGCAGGAGGTGCCAGG + Intergenic
1002795097 6:465638-465660 AAGGAGAAAGAGGATGGGGCAGG - Intergenic
1003194873 6:3905829-3905851 AACAAGAAGCTGGATGTGGCTGG + Intergenic
1003395135 6:5746587-5746609 AGGTGGCAGCAGGATTTGGCTGG + Intronic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1003824319 6:9935940-9935962 AGTGAGAAGCAGGAGGATGCTGG - Intronic
1004199502 6:13534650-13534672 AGGGAGCAGCCCGACGTGGCTGG + Intergenic
1004246804 6:13985835-13985857 AGGGAGAAGGGGGAAGTGCCAGG - Intergenic
1004667580 6:17762534-17762556 AGGGGCAAGGAGGGTGTGGCAGG - Intronic
1004785589 6:18964118-18964140 AGAGAGAATCAGGATATGGTGGG - Intergenic
1006501547 6:34462573-34462595 AGGGAGAGGGAGGAGGTGGGTGG - Intergenic
1006515680 6:34544396-34544418 GGGGGGCAGCAGGAGGTGGCTGG + Exonic
1006924240 6:37645762-37645784 AAGGAGAAGCAGGGTTGGGCTGG - Intronic
1006986446 6:38178730-38178752 TGGGAGCAGCAGGGTGTGGGGGG + Intronic
1007111280 6:39314583-39314605 AGGGAGAAGGAGGAAGCTGCTGG + Intergenic
1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG + Intergenic
1007227182 6:40323169-40323191 AGGAAGAAGCAGGATCAGGGTGG + Intergenic
1007494857 6:42252676-42252698 TGGGAGAAGGAGGTGGTGGCTGG + Intronic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1008289493 6:49696302-49696324 TAGGAGTAGCAGGTTGTGGCAGG + Intronic
1009588322 6:65635393-65635415 AGGGAAAGGCAAGATGGGGCGGG - Intronic
1010037559 6:71343930-71343952 AGGAGGGAGCAGGAAGTGGCAGG + Intergenic
1010854313 6:80818662-80818684 AGGTAGAAGAAGGTTGAGGCTGG + Intergenic
1010991205 6:82482310-82482332 AGAGAGAAGGAGGAAGGGGCTGG - Intergenic
1011551585 6:88535508-88535530 AAGGAGAAGTGGGTTGTGGCAGG + Intergenic
1013470516 6:110460165-110460187 AGGGAGCATCAGGATGCAGCGGG - Intronic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014273851 6:119365021-119365043 AGGGAGAAAGTGGAAGTGGCTGG - Intergenic
1014438276 6:121444853-121444875 AGTGAGTAACATGATGTGGCAGG - Intronic
1014773398 6:125482214-125482236 TGGGAGAGGCAGCATGTAGCAGG + Intergenic
1015585405 6:134771058-134771080 ACTGAAAAGCAGGACGTGGCTGG - Intergenic
1015769623 6:136755231-136755253 AGAGAGGAGCTGGATGCGGCTGG - Intronic
1016100889 6:140098758-140098780 AGGGAGCAGGAGAATGTGACGGG + Intergenic
1017019783 6:150130866-150130888 TGGGAGGAGCAGGAAGAGGCTGG + Intergenic
1017375076 6:153759735-153759757 AGTGAAAAGCAGGCTGTAGCAGG + Intergenic
1018163231 6:161068448-161068470 AAGGAGAAGAAGGTGGTGGCAGG + Intronic
1018434950 6:163751403-163751425 AGGGAGGAGGAGGAGGTGGGAGG - Intergenic
1018630408 6:165817161-165817183 TGGGAGAAGAAAGATGTGACAGG - Intronic
1018800406 6:167217829-167217851 AGGGACAGGGAGGGTGTGGCTGG - Intergenic
1018809749 6:167289516-167289538 AGGGACAGGGAGGGTGTGGCTGG + Intronic
1018990380 6:168669245-168669267 AGGGGGACGCAGGATGTTGTGGG - Intronic
1019034402 6:169042296-169042318 AGGAAGAAAGAGGATGTTGCAGG + Intergenic
1019468092 7:1201535-1201557 AGGAAGAAGATGCATGTGGCTGG + Intergenic
1019477895 7:1252756-1252778 AGGGACAAGAAGCAGGTGGCCGG + Intergenic
1019520461 7:1458608-1458630 TGGGAGCAGCAGGAGGTGGCAGG - Intronic
1020179795 7:5913530-5913552 AGGAAGGAGCGGGATGTGTCAGG + Intronic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020268089 7:6574998-6575020 AGGCTGAGGCAGGATGAGGCAGG - Intergenic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020303141 7:6811354-6811376 AGGAAGGAGCGGGATGTGTCAGG - Intronic
1021312569 7:19111948-19111970 AGTAAGAAGGAGCATGTGGCAGG - Intronic
1021809766 7:24391986-24392008 AGGTAGAAGTGGGATGTAGCTGG - Intergenic
1022819864 7:33948979-33949001 AGGGAGAAGGGGGCTGTGCCCGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023007245 7:35885091-35885113 TGGGAGGAGCATGATGTGGGAGG - Intronic
1023021662 7:36016952-36016974 AGAGAGAGGCAGGATGGGGCTGG - Intergenic
1023291486 7:38672726-38672748 AGGGAGATCCAGGGTGTGGCTGG - Intergenic
1023372106 7:39522025-39522047 AGGCTGAGGCAGGATGAGGCAGG + Intergenic
1023567813 7:41540940-41540962 AGGAAGAAACAGGAGGAGGCTGG + Intergenic
1023604310 7:41914724-41914746 AGAGGGAAGAAGGAGGTGGCTGG + Intergenic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1024406872 7:48992214-48992236 TGAGAGAAGCTTGATGTGGCAGG + Intergenic
1025039128 7:55624346-55624368 ATAAAGAAGCAAGATGTGGCTGG - Intergenic
1026325469 7:69305661-69305683 AGAGAGAAGGAGGAGGTGACAGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027501521 7:78957847-78957869 AGGGAGCAGCAGCATCAGGCTGG - Intronic
1028270657 7:88784687-88784709 AGGCAGAAGCAGGATTTGGTGGG - Intronic
1028548994 7:92035793-92035815 TGGGAGAAGCAGGCTGTAGTGGG + Intronic
1029443061 7:100598592-100598614 AGAGAGAGGCAGGAAGCGGCAGG + Intronic
1029460509 7:100691586-100691608 AGGTAAGAGCAGGAGGTGGCGGG + Intergenic
1029558252 7:101285423-101285445 AGGGACACGAAGGATGTGTCTGG - Intergenic
1029624352 7:101710586-101710608 AAGCAGAAACAGGATGTGCCTGG + Intergenic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031133737 7:117862590-117862612 AGGGAGGAGCAGAGTGTGCCTGG - Intronic
1031496449 7:122454880-122454902 AGGGATAAGCAGATAGTGGCTGG - Intronic
1031925329 7:127633176-127633198 AGGAAGAAGGAGCATGTGGGAGG + Intergenic
1032883641 7:136115689-136115711 GGGGCAAAGCTGGATGTGGCTGG + Intergenic
1034224383 7:149471507-149471529 AGGGAGGAGCAGGTTTGGGCAGG - Intergenic
1034282515 7:149864039-149864061 TGGGCGAAGCTGGATGTGGAAGG + Intronic
1034357745 7:150466036-150466058 ACAGAGAAGCATGATGTGGTGGG - Intronic
1034359146 7:150478714-150478736 AGGAATAAGCAGGCTGGGGCTGG + Exonic
1035300392 7:157893590-157893612 CGGGAGAAACAGGCTGCGGCAGG + Intronic
1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG + Intergenic
1036643818 8:10600060-10600082 AGAGGGGAGCAGGATGTGGGTGG - Intergenic
1036662342 8:10716347-10716369 CAGGAGCAGGAGGATGTGGCTGG - Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037944022 8:22975239-22975261 AGGTAGAAACAGGGTGGGGCAGG - Intronic
1038347378 8:26744848-26744870 AGAGAGCCTCAGGATGTGGCTGG - Intergenic
1038427257 8:27471862-27471884 AGGCAGCTGCAGGATGGGGCTGG + Intronic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG + Intronic
1039553592 8:38460806-38460828 GAGGTGAAGCAGGAGGTGGCAGG - Intronic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1041625873 8:60025942-60025964 AGGAAGAAGCAGGGTGTGTGTGG - Intergenic
1042039593 8:64577971-64577993 AGGGAGAGGAGGGAGGTGGCAGG + Intergenic
1042317803 8:67442989-67443011 AGGGAAAAGAAGGATGGGGCTGG - Intronic
1043161479 8:76852933-76852955 AGGGAGGAGGAGGAGGTGGCGGG - Exonic
1043796304 8:84546065-84546087 TGTGAGAAGGAGGAAGTGGCAGG + Intronic
1044084077 8:87921887-87921909 AGGGTGGGGCAGGAGGTGGCAGG - Intergenic
1044559347 8:93597187-93597209 AGGGAGAAGGAAGATGTCGCAGG - Intergenic
1045266554 8:100623489-100623511 AGGGAGGAGGAGAGTGTGGCTGG - Intronic
1045311429 8:101006641-101006663 ACGGAGAGGCAAGATGTGGTAGG - Intergenic
1045392139 8:101726093-101726115 AGCAAGATCCAGGATGTGGCTGG + Intronic
1045554935 8:103206780-103206802 GGAGAGAAGCAGGATGGGGCAGG + Intronic
1045632033 8:104135660-104135682 ACAGAGAAGCAGCATGTGGTAGG + Intronic
1045677057 8:104618797-104618819 AGGGAGGAGAGGGATCTGGCAGG + Intronic
1045689926 8:104749779-104749801 AGTGAGAAGCTTGGTGTGGCTGG + Intronic
1045951231 8:107853989-107854011 GGGAAGGAGCAGAATGTGGCAGG - Intergenic
1046057663 8:109097990-109098012 AGGGAGATACTGGATGTGGGAGG - Intronic
1046424398 8:114027611-114027633 AGGGAGGAGCAGGATTTCGGAGG + Intergenic
1046752592 8:117941048-117941070 TGTGAGAAGCAGGATGGGGCAGG - Intronic
1047192987 8:122695467-122695489 AGGGAGCAGGAGGATGAGGGGGG + Intergenic
1047198188 8:122740622-122740644 AGGGAAAAGTGGGATGTGTCAGG - Intergenic
1047324624 8:123824598-123824620 AGGAAGAGGCAGGATGGGGGTGG - Intergenic
1047360719 8:124166445-124166467 AGGTAGCAGCAGGGTGGGGCTGG - Intergenic
1047566243 8:126047107-126047129 AGGGTGATGCAGGGTGGGGCGGG - Intergenic
1047800209 8:128301286-128301308 AGGGAAAAGGAGGAGGTGGAGGG + Intergenic
1048179207 8:132179995-132180017 GAGGAGAAACAGGAAGTGGCGGG - Intronic
1048184293 8:132225366-132225388 AGTGAGAAGGAGATTGTGGCTGG + Intronic
1048512650 8:135076710-135076732 AGGGATAAGGAGGATGTAGTGGG - Intergenic
1048879081 8:138858531-138858553 AGGGGAAAGCTGGATGTGGTGGG - Intronic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049561390 8:143313252-143313274 AGAAAGAAGAAAGATGTGGCCGG + Intronic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1050698169 9:8302780-8302802 AGGGAGATGAAGGAGGTGCCAGG - Intergenic
1050847830 9:10245748-10245770 AGGGGGAAGACAGATGTGGCAGG + Intronic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1051848912 9:21486320-21486342 AAGAAGAAGCAGGAGGTGGTAGG - Intergenic
1052760699 9:32588120-32588142 AGTCAGAGGCAGGCTGTGGCTGG - Intergenic
1053202494 9:36162293-36162315 AGCCTGAAGAAGGATGTGGCAGG - Intronic
1054735403 9:68745207-68745229 GGGGAGAAGCAGGGAGGGGCAGG + Intronic
1055340796 9:75280742-75280764 AGAGGGAGGCAGGATGAGGCTGG - Intergenic
1055685111 9:78764871-78764893 AGGTAGCCTCAGGATGTGGCCGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056800107 9:89685209-89685231 AGGGAGAAGCAGGCGCTGACTGG - Intergenic
1057051573 9:91928075-91928097 AGTGTGATGCAGGAGGTGGCGGG - Intronic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057302499 9:93894948-93894970 AGGGAGATGCAGGAAGGGGGCGG - Intergenic
1057302504 9:93894958-93894980 AGGGAGAAGCAGGGAGATGCAGG - Intergenic
1057841088 9:98486055-98486077 GGAGGGAAGCAGGATGAGGCAGG - Intronic
1057977058 9:99616921-99616943 AGGGAGCAGAAGGATGCAGCAGG + Intergenic
1058553226 9:106138134-106138156 AGGCAGAAGGAGGAGGTGGAAGG - Intergenic
1058865809 9:109161197-109161219 AGGGAAAAGCTGGTTGTGTCTGG - Intronic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059259398 9:112961500-112961522 TGGGAGAAGCAGGAGGTAGAGGG - Intergenic
1059356070 9:113700416-113700438 AGGGAGAAGGAGGATATTTCAGG + Intergenic
1059367334 9:113796905-113796927 AGGGAACAGCAGGATGTGCAAGG + Intergenic
1059715149 9:116906413-116906435 CGGGAGAAGCAGGATGGGAGTGG + Intronic
1060155726 9:121318629-121318651 GCAGAGGAGCAGGATGTGGCTGG - Intronic
1060224062 9:121780759-121780781 AGGGAGCAGCAGGACGGAGCCGG + Intronic
1060523952 9:124310017-124310039 AGGCTGGAGCAGGAAGTGGCAGG + Intronic
1060597462 9:124856891-124856913 AGGTAGGAGCAGGATGGGCCCGG - Intronic
1060624170 9:125095286-125095308 GGGAAGAAGCAAGATTTGGCAGG - Intronic
1060636828 9:125205956-125205978 ACGGAGAGTCAGGAGGTGGCTGG + Intronic
1060730385 9:126033439-126033461 GGGGAGATGCAGGAAGGGGCTGG - Intergenic
1061078375 9:128355373-128355395 AGGGAGGGGCCGGATGAGGCAGG - Intronic
1061578393 9:131522167-131522189 AGGGAGCAGAAGGATTTGGAAGG - Exonic
1061590487 9:131594610-131594632 AGGGTGAAGCACCCTGTGGCAGG - Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1185613815 X:1408379-1408401 TGGGAGTAGCAGCATTTGGCTGG - Intronic
1185613881 X:1408799-1408821 TGGGAGTAGCAGCATTTGGCTGG - Intronic
1185613898 X:1408904-1408926 TGGGAGTAGCAGCATTTGGCTGG - Intronic
1185613912 X:1409009-1409031 TGGGAGTAGCAGCATTTGGCTGG - Intronic
1185613978 X:1409429-1409451 TGGGAGTAGCAGCATTTGGCTGG - Intronic
1186032184 X:5380313-5380335 AGGGAAAGGCAGGATGGGGGTGG - Intergenic
1186458858 X:9732416-9732438 TGGGAAAAGCAGGAAATGGCGGG + Intronic
1186600284 X:11029421-11029443 ACAAAGAAGCAGGATTTGGCAGG - Intergenic
1186852086 X:13590607-13590629 AGAGAGAAGGAGGTTGGGGCAGG - Intronic
1187179858 X:16934123-16934145 TGAGGGAAGCAGGATGGGGCTGG + Intergenic
1187276087 X:17817643-17817665 AGGGAGAAGCAGCAGGTCCCTGG + Intronic
1187579966 X:20596875-20596897 AGGGAGAGGCAAGAAGTGGAAGG + Intergenic
1189157839 X:38777761-38777783 AGTGAGAAGCAAGATGAGACTGG + Intergenic
1189245841 X:39562705-39562727 AGAGAGAAGGAGGAAGTGCCAGG + Intergenic
1189820954 X:44870023-44870045 AGGGAGAAGGAGGAAGTGATGGG + Intergenic
1189943497 X:46152819-46152841 AGGCAGAAGGAGGTTGTGGGAGG - Intergenic
1190236075 X:48616768-48616790 AGGAGGAAGCAGGATCGGGCAGG + Intergenic
1190619326 X:52269592-52269614 AGGGTGGAGTAGGATGGGGCGGG + Intergenic
1191007513 X:55726018-55726040 AGAGGGAAGCAGGAAGTGGGTGG + Intronic
1191850429 X:65582040-65582062 AAGGCAAAGCAGGATGTGGTTGG + Intergenic
1192021110 X:67392222-67392244 AGGGAGTGGCAGGATGTAGGAGG + Intergenic
1192433660 X:71129153-71129175 AAGGTGAAGGAGGATGCGGCAGG - Exonic
1195369623 X:104159981-104160003 TGAGAGAAGCAGGATATGGCTGG - Intergenic
1195731281 X:107970355-107970377 GGGAAGAAGCAGGGTGTGGACGG - Intergenic
1197764305 X:130049959-130049981 AGGGAGAAGCAGGCTGGGTGGGG + Intronic
1197872225 X:131071241-131071263 AGGGAGCAGCAGTTTGAGGCTGG - Intronic
1198710293 X:139494552-139494574 GGGGAGGAGCAGGGTGTGGTAGG - Intergenic
1200087444 X:153614660-153614682 AGAGAGAAGGAGGAGGTGGGTGG - Intergenic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201387852 Y:13462580-13462602 AGGGACATGCAGGTTGTAGCAGG + Intronic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic
1202050580 Y:20776324-20776346 GGGCAGTAGCAGGATGTGGGTGG + Intronic