ID: 1113144080

View in Genome Browser
Species Human (GRCh38)
Location 13:107187444-107187466
Sequence GCAGAATTATCTGCAGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113144075_1113144080 4 Left 1113144075 13:107187417-107187439 CCTTTAATTGTCAAGTCTCTCCA 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1113144080 13:107187444-107187466 GCAGAATTATCTGCAGGGTGAGG 0: 1
1: 0
2: 0
3: 16
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113144080 Original CRISPR GCAGAATTATCTGCAGGGTG AGG Intronic
901828532 1:11878471-11878493 GGAGAAGTACCTGCAGGCTGTGG + Intergenic
902853161 1:19177703-19177725 GCAGAATGCCCTGCAAGGTGTGG - Exonic
903708330 1:25303318-25303340 GCAGACTTATGTGCACAGTGCGG + Exonic
903718784 1:25389095-25389117 GCAGACTTATGTGCACAGTGCGG - Exonic
904254626 1:29247032-29247054 GAAGAAGAAACTGCAGGGTGCGG - Intronic
905017366 1:34786880-34786902 GCCGAATAAAATGCAGGGTGAGG - Intronic
905440724 1:37995237-37995259 GCTGCATTTCCTGCAGGGTGAGG + Intergenic
905787055 1:40766825-40766847 GCAGAAGGATATGGAGGGTGTGG - Intronic
906652373 1:47521823-47521845 AGAGTATTATTTGCAGGGTGAGG + Intergenic
910205116 1:84742233-84742255 GCAGACTTTACTGCAGGGCGGGG - Intergenic
913283259 1:117205552-117205574 CCAGAATTAGCTGCAGCCTGTGG - Intronic
917577571 1:176340053-176340075 GCAGCATTTTCTGCTGGCTGTGG + Intergenic
919712792 1:200744905-200744927 ACAGAATTATGTGAAGGGTGAGG + Intronic
922651097 1:227339096-227339118 GGAGATTTATCTGCAGCATGTGG + Intergenic
923552959 1:234978776-234978798 GCTGAATTATCTGCAGTGCGTGG - Intergenic
923631533 1:235651746-235651768 TCAGAATTACCTGGAGGGTTTGG - Intergenic
923800656 1:237205534-237205556 GCAGAATTTGGTCCAGGGTGAGG + Intronic
1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG + Intergenic
1066444081 10:35465880-35465902 TCAGGATTATCAGCAGGGTAGGG + Intronic
1066569943 10:36760476-36760498 GCAGAAATAGATGCAGGCTGAGG - Intergenic
1067792503 10:49298755-49298777 GCAGAATAATCTGCAGCTAGGGG - Intergenic
1073002019 10:100292991-100293013 GCAGAAGGTCCTGCAGGGTGGGG - Exonic
1073469568 10:103714376-103714398 ACAGGATTTTCTTCAGGGTGGGG - Intronic
1075207507 10:120459715-120459737 AAAGAATTATCTGCGGGGAGAGG + Intronic
1075847397 10:125555775-125555797 GCAGACTCACCTCCAGGGTGGGG - Intergenic
1077918243 11:6624859-6624881 GCAGCATTACCTGAAGTGTGAGG + Exonic
1078421742 11:11218265-11218287 GCAGAATTCTCTGCAGGGCAAGG + Intergenic
1084795147 11:71500527-71500549 AAAGAATTCTCTGCTGGGTGTGG - Intronic
1085289417 11:75387026-75387048 GCAGAACTTTGAGCAGGGTGTGG - Intergenic
1085447974 11:76614160-76614182 GCAGAAGTAAGTGCAGGCTGTGG + Intergenic
1085549642 11:77356747-77356769 GCAGCATTTTGTACAGGGTGAGG - Intronic
1090489490 11:127145827-127145849 TGAGAATTATCTGGAGGGTTTGG + Intergenic
1092020687 12:5200017-5200039 CCAGAATTCCCTGCTGGGTGTGG - Intergenic
1092785384 12:12022026-12022048 ACATAATTATCTGCTGGGCGAGG + Intergenic
1094230554 12:28097645-28097667 GAAGAATTATTTGCAGGAGGTGG - Intergenic
1095839780 12:46680567-46680589 TCAAAATTATGAGCAGGGTGGGG - Intergenic
1100719022 12:97337265-97337287 GCAGAATTAGAAGGAGGGTGTGG - Intergenic
1101800339 12:108016380-108016402 GAAGGCTTATCAGCAGGGTGGGG + Intergenic
1102219338 12:111183812-111183834 TCACAAATATCTGCAGGGGGTGG - Intronic
1103114530 12:118315213-118315235 GAAAAATTTTCTGCTGGGTGTGG - Intronic
1103682142 12:122702636-122702658 CCAGAATTATCTGGAGCCTGCGG - Exonic
1103683885 12:122716090-122716112 CCAGAATTATCTGGAGCCTGCGG - Exonic
1104230313 12:126878090-126878112 GCAGAATAATCAGGCGGGTGAGG + Intergenic
1106039656 13:26077432-26077454 CCAGAATTATCTGCAGCTTAAGG - Intergenic
1111242382 13:85492328-85492350 GCAGTCTTTTCTGCAGGCTGTGG + Intergenic
1111982537 13:95032220-95032242 GCAGAATTATAGGCAGAGTCCGG - Intronic
1113144080 13:107187444-107187466 GCAGAATTATCTGCAGGGTGAGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1115416245 14:33137933-33137955 ACAGAATTATCTGGTAGGTGTGG + Intronic
1116456688 14:45127710-45127732 GAAGATTTTTCAGCAGGGTGTGG + Intronic
1118308458 14:64675423-64675445 CCAGAGTTATCCACAGGGTGGGG - Intergenic
1118843612 14:69529707-69529729 GCTGAAATCTCTGCAGGGAGAGG - Exonic
1119766792 14:77195572-77195594 TCAGAATCATCTGCAGGAGGAGG - Intronic
1120376699 14:83717755-83717777 GCTGAATTATCTGCATGCTATGG - Intergenic
1202943067 14_KI270726v1_random:1198-1220 ACAGCATCCTCTGCAGGGTGAGG + Intergenic
1125380395 15:39080741-39080763 GCAGCATTCTTTGGAGGGTGTGG - Intergenic
1125676177 15:41503660-41503682 TTAGAAGCATCTGCAGGGTGGGG + Exonic
1125852273 15:42915513-42915535 GCATAATTATCTATAGGGTAAGG + Intronic
1125973194 15:43928906-43928928 TCAGAAGTAGCTGCAGGGTGAGG - Intronic
1126762413 15:51981181-51981203 TCAGACTTATCGGCCGGGTGCGG + Intronic
1127099075 15:55546111-55546133 GCAGAAGCATCTGCAGTATGGGG - Exonic
1131372550 15:91894799-91894821 GCAGAAGCATGTGCAGGGTGAGG - Intronic
1135278995 16:21137711-21137733 GAAGAACTATCAGCTGGGTGTGG - Intronic
1137748267 16:50839763-50839785 TCAGATATACCTGCAGGGTGGGG + Intergenic
1138510649 16:57506868-57506890 GCACAATGATCTGAAGGGAGAGG + Intergenic
1141782219 16:86170513-86170535 GCAAAATTATCTGCATTGTACGG + Intergenic
1143111946 17:4557966-4557988 GCAGAGTTATCTGAAGCATGGGG - Exonic
1144709559 17:17392454-17392476 GTAGAATTCTCTCCAGAGTGTGG + Intergenic
1147133840 17:38424192-38424214 GGAAAAGTATCTGGAGGGTGGGG - Intergenic
1148675395 17:49441937-49441959 CCAGAATTATCTTCAGAGTGGGG - Intronic
1151001841 17:70385922-70385944 TAAGAAATATCTGCTGGGTGCGG + Intergenic
1151331268 17:73410605-73410627 GCAGCATTATCGGCCGGGGGTGG - Intronic
1151455685 17:74224511-74224533 GAAGAATTATCTGCAGTGTAGGG + Intronic
1152624930 17:81383799-81383821 GCCGAATTTTCTGCATGATGGGG - Intergenic
1153814412 18:8780291-8780313 GCAGAGTTGCCTGCATGGTGCGG - Intronic
1153958677 18:10121860-10121882 GCAGGATTAACTTCTGGGTGTGG + Intergenic
1156830328 18:41484032-41484054 GCAGAATTCTCTGCACAGCGGGG - Intergenic
1160578479 18:79870262-79870284 GCGGAATAATCGGCAGGGAGCGG + Intronic
1163287217 19:16356211-16356233 GCAGAATTGTCTGCGCCGTGGGG - Intronic
1163831310 19:19548361-19548383 GCAGAGTTATCAGCAGGGATGGG - Intergenic
1164151347 19:22554947-22554969 AAAGAATTTTCGGCAGGGTGCGG - Intergenic
1165452633 19:35893430-35893452 GCAGAATTAGCTAGATGGTGGGG - Intronic
1167315976 19:48762878-48762900 ACAGGATGAGCTGCAGGGTGTGG + Intergenic
1167956781 19:53072041-53072063 GCAAAATTATCTGCTCTGTGTGG - Intronic
927503679 2:23599154-23599176 GCAGAATCATCTGAAGCCTGCGG + Intronic
927547676 2:23969179-23969201 GAAGAAATATCAGCTGGGTGAGG - Intronic
928170013 2:28997720-28997742 AGGGGATTATCTGCAGGGTGTGG + Intronic
929163764 2:38860107-38860129 AAAGAATTCTCTGCTGGGTGTGG - Intronic
937577195 2:123437928-123437950 GCAGCATTATCTGCAAAGTTTGG + Intergenic
944200844 2:197105897-197105919 GCAGACTTCTCTGCAGTCTGGGG - Intronic
945289573 2:208113661-208113683 AAAAAATTATCTGCTGGGTGGGG + Intergenic
947001401 2:225461099-225461121 GCAGAACTATTTGCATGGGGAGG - Intronic
947061916 2:226176510-226176532 GCTGCAGTATCTGCAGCGTGTGG - Intergenic
948204323 2:236154763-236154785 GGATAATTATCTGCTGTGTGGGG - Intergenic
1170834818 20:19875149-19875171 AAAAAATTATCTGCTGGGTGCGG - Intergenic
1171389694 20:24793372-24793394 GCAACGTTTTCTGCAGGGTGAGG - Intergenic
1172530919 20:35630851-35630873 GCTGAAGCATCTGCAGGGAGCGG + Intronic
1172751750 20:37256344-37256366 GCAGACTCTGCTGCAGGGTGTGG + Intronic
1174332545 20:49831618-49831640 GCTGAATTCTCTGCAGGGAGAGG + Intronic
1178442058 21:32606304-32606326 TCAGAGTTATCTGCAGAGGGTGG + Intronic
1179464927 21:41565560-41565582 GCAGAATTTACTGCTGGGTGTGG + Intergenic
1180593984 22:16961900-16961922 GGGGAAATACCTGCAGGGTGAGG - Intergenic
1180685309 22:17661699-17661721 GCATAATTATGTGCCGGGTGTGG + Intronic
1180860416 22:19076453-19076475 GTAGAATTACCTGCCGGGCGCGG - Intronic
1181624732 22:24115581-24115603 CCAGAACTATCTGCTGGCTGTGG - Intronic
1183371017 22:37432424-37432446 GCAGACTTTTCTGAAGGGAGTGG - Intergenic
1185183063 22:49374065-49374087 GCAGTTTTATCTGCAGGCAGAGG + Intergenic
1185370621 22:50459336-50459358 GGAGAAGTACCTGCAGGCTGTGG - Exonic
954361340 3:50124333-50124355 CCAGAAAAATCTGCAGGGTGGGG - Intergenic
954572750 3:51655827-51655849 TCAGAAGAATCTGCAGGGTCTGG - Intronic
955301784 3:57787024-57787046 ACATAATTTTCGGCAGGGTGCGG - Intronic
957137259 3:76305468-76305490 CAAGAATCATCGGCAGGGTGTGG + Intronic
958069997 3:88597836-88597858 ACAGAATTATTTCCAGGGAGAGG + Intergenic
965634530 3:170767791-170767813 GCAGAATTATCTCCACTTTGTGG + Intronic
966760466 3:183413582-183413604 GCAAAAATATCTCCAGGATGCGG + Intronic
969119958 4:4900825-4900847 GGCGACTTAGCTGCAGGGTGGGG - Intergenic
969418028 4:7073825-7073847 ACAGAATTGTCAGCAGGGAGTGG - Intergenic
970476264 4:16426932-16426954 ACAGAATTTTCTGCTGGGTTTGG + Intergenic
972259007 4:37389254-37389276 GGAGAATTATCAGCACTGTGGGG - Intronic
975359033 4:73445101-73445123 GCTGGATTGTCTGCAGGATGGGG + Exonic
977558161 4:98505476-98505498 GAAGAAGGATCTGCAGGGTATGG - Intronic
980493369 4:133559976-133559998 TCAGGACTAGCTGCAGGGTGTGG - Intergenic
980734994 4:136873249-136873271 CCAGATTTACCTGCATGGTGGGG + Intergenic
980951726 4:139385760-139385782 GCAGAATAATGTGGAGGTTGGGG - Intronic
985272130 4:188203614-188203636 GCAGAATTATGGGCCGGGCGCGG - Intergenic
986053366 5:4111278-4111300 GCAGTATTCTCTGCAGCATGTGG - Intergenic
986173113 5:5329785-5329807 GCAGAATCTTCTACAGGGTAAGG - Intergenic
987453430 5:18114370-18114392 GCAGACTGATCTACAAGGTGCGG - Intergenic
989026574 5:37075213-37075235 GTAGAATTTTCAGCTGGGTGTGG + Intergenic
992118722 5:73568286-73568308 GCATAATTATATGGAGGCTGAGG - Exonic
996817094 5:127586515-127586537 TAAGAATTATCTGCAGTTTGTGG + Intergenic
997910451 5:137866911-137866933 GTAGAATTATCTCCATGGGGTGG - Intergenic
998559335 5:143156564-143156586 TCAGAATCATCTGCAGGGTTTGG - Intronic
1000388371 5:160697583-160697605 GAAGAAATGTATGCAGGGTGGGG + Intronic
1002428347 5:179188753-179188775 GCAGAGGTATCAGCAGAGTGTGG - Intronic
1002484016 5:179522721-179522743 GAAGCATTCTCTGCTGGGTGTGG - Intergenic
1002500547 5:179644760-179644782 GAAGCATTCTCTGCTGGGTGTGG + Intronic
1005463610 6:26091318-26091340 CCAGGATGACCTGCAGGGTGTGG - Exonic
1006430599 6:33993386-33993408 GCTGCAGTGTCTGCAGGGTGGGG + Intergenic
1008626830 6:53325435-53325457 GCATAAATATCTACAGGGTGCGG - Intronic
1008788426 6:55198445-55198467 GCAGGATTTTGTGTAGGGTGAGG - Intronic
1009406334 6:63317874-63317896 TTATAAATATCTGCAGGGTGGGG + Intronic
1009831372 6:68940512-68940534 GCAGAAGTTTCTGCAGGCTAAGG + Intronic
1013553250 6:111231218-111231240 GTGGAATTCTCTGGAGGGTGGGG + Intergenic
1014865562 6:126525365-126525387 TCAGTATTTTCTGCAGGTTGAGG - Intergenic
1015043019 6:128744474-128744496 GCAGAAAAATTTGAAGGGTGAGG + Intergenic
1016654203 6:146499128-146499150 GCAGCATTATCTGAAGGAAGGGG - Intergenic
1016672596 6:146726376-146726398 ACAAAAAAATCTGCAGGGTGTGG - Intronic
1018920162 6:168166985-168167007 GCAGATTTGCCTGCAGGTTGAGG - Intergenic
1024623615 7:51185442-51185464 GCAGCTTCATCTGCAGGTTGAGG + Intronic
1029455701 7:100670633-100670655 ACAGAATGATCTGCCTGGTGGGG - Intergenic
1029948293 7:104556297-104556319 GCAGAGTTTGCTGCAGGGGGGGG - Intronic
1030105132 7:105981027-105981049 GCAGATTTATGTGAAGGATGAGG + Exonic
1030515640 7:110534407-110534429 GCTGAGTTATCTGCTGTGTGGGG - Intergenic
1032147235 7:129395200-129395222 GCAGAAGTAGCTGAAGGCTGAGG - Intronic
1032783938 7:135186100-135186122 GCAGTATTATCTGCGGTGGGGGG - Exonic
1036511303 8:9402852-9402874 TCAGCATTGTCTGCTGGGTGAGG - Intergenic
1037490427 8:19392398-19392420 GGATAATTCTCTGCAGTGTGGGG + Intronic
1037871211 8:22498832-22498854 GTAGAATTATTGGCCGGGTGCGG + Intronic
1038597666 8:28904000-28904022 GGAGAATTATCTGTTGGGAGCGG - Intronic
1039246778 8:35617304-35617326 GCAGAAAACTCTCCAGGGTGGGG - Intronic
1044534956 8:93347885-93347907 GCAGAGCTCTCTGCTGGGTGTGG + Intergenic
1044885695 8:96774575-96774597 GCAGAATTACAGGCAGGGTTTGG + Intronic
1044906748 8:97012508-97012530 GCAGAGTTATGTGCTGAGTGTGG - Intronic
1045605089 8:103763976-103763998 TCAGAATTACCTGGAGGGTTTGG + Intronic
1047832794 8:128654879-128654901 ACAGAATTATATGCAGTGGGGGG + Intergenic
1049082491 8:140454346-140454368 GCAGCATAATCAGCCGGGTGTGG + Intronic
1049671344 8:143871426-143871448 GCAGAGGTACCTGCAGGGTACGG - Exonic
1049785386 8:144448320-144448342 GCAGACGTCTCTGCAGGTTGGGG - Intergenic
1051210788 9:14740386-14740408 TAAAAAGTATCTGCAGGGTGGGG + Intronic
1051993849 9:23189334-23189356 TCAGATTTTTCTGCAGTGTGAGG + Intergenic
1055619907 9:78114077-78114099 ATAGTATTATCTGCTGGGTGTGG + Intergenic
1055680795 9:78712887-78712909 ACAGAATTCTCTGCAGGGATTGG + Intergenic
1057447131 9:95124471-95124493 GCACAATCTTCTGCAGGGTGCGG + Intronic
1057733005 9:97627919-97627941 GAAGAATAATCAGCAGGGTAGGG + Intronic
1057867649 9:98693863-98693885 TCAGAATTCTCTGCATGCTGTGG - Intronic
1059989436 9:119851249-119851271 GCAGAATTTTTTGCAGGGGCTGG + Intergenic
1061363819 9:130160041-130160063 GCAGAATCAGCTGGAGGGAGTGG - Intergenic
1062085318 9:134645229-134645251 CCAGAAATATCTGCAGGGCGGGG - Intronic
1062153843 9:135035048-135035070 GCAGGATTACCAGCCGGGTGTGG + Intergenic
1203779025 EBV:90506-90528 GTAGAATTGTCTCCAGGTTGAGG + Intergenic
1187103131 X:16215364-16215386 GCAGCCTAAACTGCAGGGTGGGG - Intergenic
1187397932 X:18934290-18934312 GTAGACTGATCTGCAGAGTGAGG + Intronic
1190271729 X:48869525-48869547 AAAGAATTTTCTGCCGGGTGCGG + Intergenic
1195400267 X:104453870-104453892 ACAGAATGATGTGCAGGGTGGGG + Intergenic
1195651492 X:107289586-107289608 CCAGAATGAGCTGCAGGCTGGGG - Intergenic
1197238441 X:124095215-124095237 GGAAAATTATCAGCCGGGTGCGG - Intronic
1198447894 X:136736914-136736936 GCACAGCAATCTGCAGGGTGAGG + Intronic
1200706899 Y:6450732-6450754 GTAGATTTTTCTGCAGGGGGAGG + Intergenic
1201027213 Y:9713976-9713998 GTAGATTTTTCTGCAGGGGGAGG - Intergenic