ID: 1113148171

View in Genome Browser
Species Human (GRCh38)
Location 13:107232176-107232198
Sequence CAAAGCCAAGGTAATTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113148166_1113148171 14 Left 1113148166 13:107232139-107232161 CCTCCTTTGCAGTCGCCATTACG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1113148171 13:107232176-107232198 CAAAGCCAAGGTAATTAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 149
1113148167_1113148171 11 Left 1113148167 13:107232142-107232164 CCTTTGCAGTCGCCATTACGTAA 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1113148171 13:107232176-107232198 CAAAGCCAAGGTAATTAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 149
1113148168_1113148171 -1 Left 1113148168 13:107232154-107232176 CCATTACGTAAGCGCTCTGAAAC 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1113148171 13:107232176-107232198 CAAAGCCAAGGTAATTAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113148171 Original CRISPR CAAAGCCAAGGTAATTAGGT AGG Intronic
903238232 1:21964627-21964649 CAAAGCCTAGGGCATTAGGCCGG - Intergenic
904590486 1:31612419-31612441 CAAAGCCACTGTCATTTGGTGGG + Intergenic
911201089 1:95044242-95044264 CAAAACCAAGGAAATCAGTTAGG - Intronic
911432369 1:97807917-97807939 CAAAGACAAGTTGATTATGTAGG + Intronic
911462991 1:98214052-98214074 CCCAGCCAGGGTAATTAGGCAGG - Intergenic
915598232 1:156907344-156907366 CCAAGCCAAGGTGAGGAGGTGGG + Intronic
916672659 1:167037120-167037142 CCAAGTCAAGGTATTTAGGGTGG + Intergenic
919052293 1:192526059-192526081 AAAACCCAAGCTCATTAGGTTGG + Intergenic
919107039 1:193166585-193166607 CAAAACCACGGAAATTATGTAGG + Intronic
1065408538 10:25395515-25395537 CAAAGCAAAGGTAGGTAGGTGGG - Intronic
1067053387 10:43037882-43037904 GAAAACCAAGGGAATTAGTTGGG - Intergenic
1068608923 10:59037164-59037186 CAAAGCAAAGGTAGCTAGGGTGG + Intergenic
1071196174 10:83162801-83162823 CAGAGCCCAGGTATTGAGGTTGG + Intergenic
1073363403 10:102918155-102918177 CAATGGCAAGGTAAGTGGGTGGG - Intergenic
1073533686 10:104255254-104255276 GAAGGCCAAGGGAATCAGGTGGG + Exonic
1073729695 10:106273288-106273310 AATAGCCAAGGGAAATAGGTTGG + Intergenic
1074285944 10:112098381-112098403 CAAAGCAAAGGAAATCAGATTGG - Intergenic
1075246499 10:120827151-120827173 CAAGGCCCAGGCAATGAGGTGGG + Intergenic
1078810375 11:14755778-14755800 CAAAATCAAGGTTATTATGTAGG - Intronic
1079793032 11:24763190-24763212 GAAAGCCATGGTAATGAGTTTGG + Intronic
1081975134 11:47229062-47229084 CAAACCAAAAGTCATTAGGTAGG + Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1085416184 11:76320590-76320612 CAAAGCCACGGGATTTGGGTAGG - Intergenic
1086238498 11:84660809-84660831 CAAAGGCAAGGTGACTAAGTGGG + Intronic
1086893870 11:92290042-92290064 CAAAGCAAAGGCCATCAGGTGGG - Intergenic
1087124225 11:94607181-94607203 AAAAGCCAAGGGAAATGGGTAGG + Intronic
1087206586 11:95402633-95402655 CAAAACAAAGGTAAATAGATGGG - Intergenic
1089000156 11:115045115-115045137 AAAAGCCAGGGTAAGGAGGTAGG - Intergenic
1091189343 11:133677351-133677373 CAAAGACAAGGTATCTAAGTAGG + Intergenic
1093919812 12:24847165-24847187 CATGCCCAAGGCAATTAGGTTGG + Intronic
1095807866 12:46340616-46340638 AAAAGCAAAGATAAATAGGTGGG - Intergenic
1095886498 12:47193965-47193987 CAAAGCCAAGGGAGGTAGGCAGG - Intronic
1096038332 12:48492476-48492498 TACAGCCCAGGTAATCAGGTGGG - Intronic
1096497065 12:52044725-52044747 CAGAGGCAAGGGAATTTGGTGGG + Intronic
1097746893 12:63312690-63312712 AATAGCCAAGGAAAATAGGTTGG - Intergenic
1101624498 12:106425564-106425586 GAAAGCCCAGGGAAGTAGGTAGG + Intronic
1102933811 12:116881090-116881112 CACAGCCAAGGCCAGTAGGTGGG + Exonic
1106550249 13:30764887-30764909 CACAGCCATGTGAATTAGGTTGG + Intergenic
1110072121 13:71190544-71190566 CAAAAACAAGGTAACTGGGTTGG - Intergenic
1112694237 13:101929578-101929600 CAACGCCCAGGTAATTGAGTGGG - Intronic
1113148171 13:107232176-107232198 CAAAGCCAAGGTAATTAGGTAGG + Intronic
1118489747 14:66247568-66247590 CAGAGAGAAGGGAATTAGGTGGG - Intergenic
1119066608 14:71534237-71534259 CAAACCAAGGGTAATGAGGTTGG - Intronic
1120157413 14:81109046-81109068 CAAAACCAAGGGAATGAGGAAGG - Intronic
1120308456 14:82800376-82800398 CAAAGCCAAGGTCATTCTGAAGG - Intergenic
1120831800 14:89003999-89004021 GAAATCAAAGGTAATAAGGTGGG - Intergenic
1121863096 14:97337731-97337753 TCAAGCCAAGGTCATTTGGTTGG + Intergenic
1122670003 14:103364168-103364190 CAAAGCCAAGCAAATTATTTAGG - Intergenic
1125020008 15:34975172-34975194 CTAAGCCAGGGTAATTGGCTTGG - Intergenic
1127470516 15:59285980-59286002 CACAGCCAAGGTAATGAGGCAGG + Intronic
1127866745 15:63039682-63039704 CACAGCCAACTTAATTGGGTGGG + Intergenic
1131464022 15:92640253-92640275 TAAAGTCAAGGTAAATAGGCGGG + Intronic
1133333562 16:4991645-4991667 CCAAGCCTTGGAAATTAGGTGGG + Intronic
1135266638 16:21032143-21032165 AAAAGCCAAGGTTCTTAGGGTGG - Intronic
1142932188 17:3295698-3295720 CAAAACCAAGTTAATTAGAAAGG + Intergenic
1144035479 17:11361529-11361551 AAAAGCTGAGGTAATTAAGTGGG + Intronic
1144249619 17:13402570-13402592 AAAAGCCCAGGTAATTACCTTGG - Intergenic
1146487550 17:33256052-33256074 CAAATCCATGGTAATTAGTCTGG - Intronic
1150336335 17:64333279-64333301 CAGAGCCACAGTAATCAGGTGGG + Intronic
1153367307 18:4271758-4271780 AAAAGCAAAGGGAAATAGGTGGG - Intronic
1153507701 18:5818930-5818952 CAAAGGCAAGGCAATTATGAAGG - Intergenic
1157010871 18:43646977-43646999 GAAAGTCAGGGTAATAAGGTAGG + Intergenic
1158650395 18:59279205-59279227 CAGAACCAAGATAATTGGGTTGG - Intronic
1159453633 18:68633952-68633974 CAAAACAAAGATAAATAGGTGGG - Intergenic
1159930591 18:74309363-74309385 CAATGACAAGTTAATTATGTAGG + Intergenic
1160240063 18:77116995-77117017 CAAAGACCAGGTCATCAGGTTGG - Intronic
1162053004 19:8046441-8046463 GAAAGCCAAGGTCATGAGCTCGG + Intronic
1163022959 19:14493426-14493448 CAAGGCCAAGGTCTTTAGGCTGG - Intronic
926363231 2:12109849-12109871 CAAAAGCAAGGTCATTAGGGTGG - Intergenic
926902621 2:17771081-17771103 CAAAGGGAAAATAATTAGGTAGG + Intronic
929387161 2:41423187-41423209 AAAAGCAAAGATAAATAGGTGGG - Intergenic
938540312 2:132279747-132279769 CACAGCCAAGGGAATGGGGTTGG - Intergenic
938882850 2:135609402-135609424 CAACTCCAAGGCAATTATGTGGG - Intronic
938953788 2:136280560-136280582 CAAAGCCAATATACTAAGGTGGG - Intergenic
940762828 2:157756293-157756315 AAAAGCGAAGATAAATAGGTGGG + Intronic
942609834 2:177731899-177731921 CAAAGCCAAAGAAATTGGGAAGG - Intronic
942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG + Intronic
945034496 2:205692835-205692857 CAAAGCCCATGTAGTGAGGTGGG - Intronic
946377669 2:219323026-219323048 CAAAGAAAAGGTAATGAAGTAGG + Intergenic
1171869238 20:30512750-30512772 CACAGCCAAGGGAATGGGGTTGG - Intergenic
1173457113 20:43211782-43211804 CAAAGCCAATGAAATGAGGCAGG - Intergenic
1173847097 20:46195109-46195131 CAAAACCAAGGTAACAAGATGGG + Intronic
1178043783 21:28671338-28671360 AAAACCCAAGGTAATAAAGTGGG + Intergenic
1178098446 21:29240326-29240348 AAAAGCCAAGGAAAGAAGGTTGG - Intronic
1178966838 21:37128167-37128189 CAGAGCCAATGTAATAAGGAGGG - Intronic
1180166325 21:46032503-46032525 CAAAGCCACAGTAATCAGGGTGG - Intergenic
1181821321 22:25477861-25477883 CAAACCCAGGGTCAATAGGTGGG + Intergenic
1185348629 22:50321989-50322011 TAAAACCAAGGAAATTAGCTGGG - Intronic
950188811 3:10962069-10962091 CTAGGCAAAGGCAATTAGGTTGG - Intergenic
951353619 3:21637110-21637132 AAAAGCAAAGATAAATAGGTGGG - Intronic
954157495 3:48694689-48694711 AGAAGCCCGGGTAATTAGGTAGG - Intronic
954199655 3:49016724-49016746 CTAAGCCAGGGTAATGAGGGGGG - Intronic
955790786 3:62587048-62587070 CAATGCCAATGTAATCAGATGGG - Intronic
956331704 3:68117387-68117409 GAAAGCCAAGTTAATAAGGATGG + Intronic
959739995 3:109707349-109707371 AAAGGACAAAGTAATTAGGTAGG - Intergenic
961025593 3:123553258-123553280 AAAGGGCAAGATAATTAGGTTGG + Intronic
970715250 4:18913858-18913880 CACATACAAGGTAACTAGGTGGG + Intergenic
971193073 4:24446179-24446201 CAAAGCCAAGATAAGAAGGACGG + Intergenic
971871840 4:32251018-32251040 CAGTGGCAAGGTAATTAGCTGGG - Intergenic
975701124 4:77067644-77067666 CCAAGCCCAGGTAATTTTGTGGG + Intronic
975890157 4:79017931-79017953 CAAAGCCAAGGAAATAAGCAAGG - Intergenic
979935838 4:126694077-126694099 AAAAGCCAAGTTAATAAAGTGGG - Intergenic
981099257 4:140812318-140812340 TTAAGACAAGGTCATTAGGTTGG - Intergenic
983054204 4:163082713-163082735 CAAAGGCAAGTTAGTCAGGTGGG + Intergenic
990155921 5:52877348-52877370 CTGAGCTAAGGTAATGAGGTAGG + Intronic
995775634 5:115722346-115722368 CACAGCCATGGTTATTCGGTGGG + Intergenic
997565558 5:134883444-134883466 CAAAGACAAAATAATTAGCTGGG + Intronic
998981800 5:147712132-147712154 CAAAGCCAAGGTGAGAATGTGGG - Intronic
999794997 5:154981038-154981060 CAAAGACAAGGTAATTGCTTGGG - Intergenic
999938074 5:156509743-156509765 CAAAGGCAAGGTATGTATGTAGG - Intronic
1000795692 5:165661711-165661733 CAAAGCCAGGATTGTTAGGTTGG + Intergenic
1004260893 6:14106847-14106869 CAAACCCAAGGTCAAGAGGTGGG + Intergenic
1004962627 6:20808353-20808375 CAATGTCAAGGTTATTATGTAGG - Intronic
1005770840 6:29069287-29069309 AAAATCCAAGATAAATAGGTGGG + Intronic
1008669562 6:53753637-53753659 CAAAGGCAAGGGAGTTGGGTTGG + Intergenic
1008819651 6:55615519-55615541 CTAATCCAATGTAATTAGGACGG + Intergenic
1010759257 6:79703479-79703501 CAAAGGAAAGGCAATAAGGTGGG - Exonic
1011290394 6:85771031-85771053 AAAAGCCAAGATAAATAGATAGG - Intergenic
1014000130 6:116356160-116356182 CATGGCCAAGGTAATGGGGTGGG + Intronic
1015793868 6:136990950-136990972 CAAAGAGAAAGTAATTAGGATGG - Intergenic
1015817331 6:137224208-137224230 GAAAGCCAATCTATTTAGGTTGG - Intergenic
1018386953 6:163313222-163313244 CAAAGCCATTGTGATTAGGTGGG - Intronic
1020433735 7:8140172-8140194 CATAGTCAAGGTAATTGGATAGG - Intronic
1021367181 7:19794320-19794342 CAAAACTAAGGAAATTAGTTTGG - Intergenic
1022272208 7:28819669-28819691 CAGATCCAAGGTAACTGGGTAGG + Exonic
1023542078 7:41276231-41276253 CAAAGCCAAGGTAGGAAAGTTGG - Intergenic
1024533111 7:50409470-50409492 CAAAGCCAATGCAATAAGGAAGG + Intergenic
1027721358 7:81745798-81745820 ATAAGCTAATGTAATTAGGTAGG + Intronic
1028013057 7:85673489-85673511 CAATGAAAAGGTAATTAGATTGG - Intergenic
1032313139 7:130807373-130807395 CACAGCCAAAGGAATTAGGAAGG + Intergenic
1034452414 7:151144058-151144080 CGAAGCCAAGGAAATTAGGGAGG + Exonic
1035489949 7:159266431-159266453 CCTAGCCAAAGTAATTAGGCAGG - Intergenic
1035596687 8:863860-863882 CAACCCCAAGGAAATGAGGTTGG + Intergenic
1039970391 8:42316927-42316949 CACAGCCAAGGTAAACAGGATGG - Intronic
1040922186 8:52633774-52633796 TAAAGCCAAGGCAGTTTGGTTGG + Intronic
1041030089 8:53728061-53728083 CAAAGGCAAGGAAACCAGGTGGG - Intronic
1043645972 8:82519062-82519084 CAAATGCAAGGTATTTATGTAGG + Intergenic
1044500872 8:92954472-92954494 CAAAGCCAAGGTCTTTAGTTAGG + Exonic
1047082724 8:121481754-121481776 CAAAGGCAAGGAATATAGGTGGG - Intergenic
1049049119 8:140179119-140179141 CAAAGCCAAAGTAACTAGAAAGG - Intronic
1051841633 9:21404301-21404323 CCAGGCCAAGTTAATTTGGTTGG - Intergenic
1052050107 9:23836780-23836802 CAAAGCATAGGAAATCAGGTTGG + Intergenic
1052107312 9:24535235-24535257 AAAAGCAAAGATAAATAGGTGGG - Intergenic
1055002315 9:71465758-71465780 CATAGCCAAGCTAATGTGGTGGG + Intergenic
1057487799 9:95499593-95499615 CACAGCCATGGTTATTATGTGGG + Intronic
1058932773 9:109737940-109737962 CAAAGCCATGCTAGTCAGGTTGG - Intronic
1187670099 X:21658380-21658402 CAAAGCCTAGGGGATTAGGGAGG + Intergenic
1188172964 X:26950696-26950718 CAAAGACTGGGTTATTAGGTTGG + Intergenic
1188859134 X:35235924-35235946 CAAAGCTAAGGTCATTAGGCAGG + Intergenic
1190938276 X:55015748-55015770 CAAAGCCAAGGGATAGAGGTAGG + Intronic
1191100757 X:56724753-56724775 AAAAGCAAAGATAAATAGGTTGG + Intergenic
1192815430 X:74585806-74585828 CAAAGTGAAGTTAATTTGGTTGG - Exonic
1193203543 X:78720824-78720846 AAAAGCAAAGATAAATAGGTAGG + Intergenic
1194036205 X:88875720-88875742 AAAAACAAAGGTAAATAGGTGGG - Intergenic
1195996795 X:110739680-110739702 CAAAGACAAAATAATTAGTTGGG - Intronic
1200764633 Y:7070205-7070227 CAAAGCCAATGGAAATAGATGGG + Exonic