ID: 1113148177

View in Genome Browser
Species Human (GRCh38)
Location 13:107232210-107232232
Sequence GCATCCAGGGTAGGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113148177_1113148188 26 Left 1113148177 13:107232210-107232232 CCTGTTATTCCTACCCTGGATGC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1113148188 13:107232259-107232281 AATGGGAAGTTCAAAATCAGGGG 0: 1
1: 0
2: 3
3: 40
4: 440
1113148177_1113148182 -4 Left 1113148177 13:107232210-107232232 CCTGTTATTCCTACCCTGGATGC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1113148182 13:107232229-107232251 ATGCCTGGCATCTACATTAGAGG 0: 1
1: 0
2: 0
3: 9
4: 104
1113148177_1113148186 24 Left 1113148177 13:107232210-107232232 CCTGTTATTCCTACCCTGGATGC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1113148186 13:107232257-107232279 CAAATGGGAAGTTCAAAATCAGG 0: 1
1: 0
2: 1
3: 19
4: 294
1113148177_1113148184 8 Left 1113148177 13:107232210-107232232 CCTGTTATTCCTACCCTGGATGC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1113148184 13:107232241-107232263 TACATTAGAGGATGTACAAATGG 0: 1
1: 1
2: 2
3: 19
4: 245
1113148177_1113148187 25 Left 1113148177 13:107232210-107232232 CCTGTTATTCCTACCCTGGATGC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1113148187 13:107232258-107232280 AAATGGGAAGTTCAAAATCAGGG 0: 1
1: 2
2: 27
3: 235
4: 1732
1113148177_1113148185 9 Left 1113148177 13:107232210-107232232 CCTGTTATTCCTACCCTGGATGC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1113148185 13:107232242-107232264 ACATTAGAGGATGTACAAATGGG 0: 1
1: 0
2: 1
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113148177 Original CRISPR GCATCCAGGGTAGGAATAAC AGG (reversed) Intronic
901954607 1:12775192-12775214 GCATCCAGGGTAGGGTTAGCTGG + Intronic
901969407 1:12895501-12895523 GCATCCAGGGAAGGGACAGCTGG - Intronic
901990032 1:13105317-13105339 GCATCCAGGGAAGGGACAGCTGG - Intergenic
902007816 1:13246187-13246209 GCATCCAGGGAAGGGACAGCTGG + Intergenic
902015765 1:13306279-13306301 GCATCCAGGGAAGGGACAGCTGG + Intronic
902026794 1:13389982-13390004 GCATCCAGGGAAGGGACAGCTGG + Intronic
910492372 1:87786681-87786703 GCAGCCAGGGTGGGAATGGCTGG + Intergenic
916023482 1:160814428-160814450 GCCTCCAGAGGAGGAACAACGGG + Exonic
921862598 1:220055166-220055188 GGATCTAGGGAAGAAATAACGGG + Intergenic
922424617 1:225481340-225481362 ACATTCAGGGTAGGAGTAACTGG - Intergenic
922744244 1:228035459-228035481 GCATACAGTTTAGGAATCACTGG + Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1063769440 10:9181239-9181261 GCCTCCAGAGTAGCAATAATGGG - Intergenic
1072418387 10:95268681-95268703 GCCTCCAGGGCAGGAAAAACAGG + Intronic
1074600351 10:114907695-114907717 GCCTCCAGGCAAGGAATACCTGG + Intergenic
1080474506 11:32577085-32577107 ACATCCAAGGTAGGAAGAAGGGG + Intergenic
1080576599 11:33605268-33605290 TCATCCTGGGTATGAATATCAGG + Intronic
1086910474 11:92466108-92466130 GTATCCAAGGTAGGAATGATAGG + Intronic
1090512355 11:127388959-127388981 GCACCCAAGGTAGGAATACTAGG - Intergenic
1092813666 12:12294528-12294550 GCAACAAGGGTAGCAATAGCAGG + Intergenic
1093026422 12:14249497-14249519 TCATCCAGGGCATGAATAACAGG - Intergenic
1093799496 12:23355901-23355923 GGAGCCAGGAGAGGAATAACTGG - Intergenic
1095690255 12:45080752-45080774 GCATCCAGGCTCGGTTTAACTGG + Intergenic
1095941787 12:47732235-47732257 GCATCCAGGGTGGGAATCAGAGG - Intergenic
1099316220 12:81085446-81085468 GCATCTGGGGAAGGAATAAATGG - Intronic
1100799606 12:98217380-98217402 TCATCCATGGTAGGAAGAGCAGG + Intergenic
1102719877 12:115006777-115006799 GAATCCAGGCTAGGCATAGCTGG - Intergenic
1104413361 12:128577811-128577833 GCATCAAGGGCAGGACTAAAAGG - Intronic
1105955044 13:25273815-25273837 GCATCCGGCCTAGGAACAACAGG + Intronic
1106020848 13:25914161-25914183 GAAGCCAGGGAAGGAAGAACTGG - Intronic
1110563130 13:76930639-76930661 GCAAAAAGGGTAGGAATAAAGGG - Intergenic
1112869106 13:103947752-103947774 CCATTCAGGGTAGAAATAGCTGG - Intergenic
1113148177 13:107232210-107232232 GCATCCAGGGTAGGAATAACAGG - Intronic
1118623764 14:67638098-67638120 GCATCCAGGGTAGATATTCCAGG - Intronic
1126036623 15:44552366-44552388 GCATCCCAGGTTGGAATTACAGG + Intronic
1135868098 16:26123428-26123450 ACTTTCAGGGTAGGAATCACTGG - Intronic
1138854912 16:60679026-60679048 GCATTGAGGGTAGGAAACACTGG - Intergenic
1140263817 16:73403367-73403389 GCATCCAGGTTGGAAATGACAGG - Intergenic
1146823177 17:36000841-36000863 GCATCCAGGGCAGGAGTCACGGG - Intronic
1153726257 18:7958661-7958683 GCTTTCAGGGTAGAAATATCCGG - Intronic
1156213298 18:34970802-34970824 TCAGCCAGTGTAAGAATAACAGG - Intergenic
1157170957 18:45404667-45404689 GCTTCCAGGGTGGGAACCACTGG + Intronic
1157509625 18:48261581-48261603 GCATCTAGGGTGGGAATCAGGGG - Intronic
1158577453 18:58650986-58651008 ACATGAAGGGTAGGAATAAAGGG + Intergenic
1159027917 18:63203032-63203054 GCATCCAGGCTGGGGAAAACAGG + Intronic
1163267814 19:16232233-16232255 GCTCCCCGGGTAGGAAGAACAGG - Intronic
926280769 2:11443965-11443987 GCATGCAGGGTAGGAGTAAAGGG + Intergenic
929270470 2:39965940-39965962 GCATTGAAGGTAGAAATAACAGG + Intergenic
932436119 2:71703437-71703459 GCATCCAGGTGAGGTAGAACTGG + Intergenic
939054287 2:137344573-137344595 CCATCCACGGGAGGAATAAGTGG + Intronic
939327826 2:140717572-140717594 GCATAAAGGGTAGTAATTACAGG + Intronic
942731436 2:179065255-179065277 CCATCCAGGCTAGGAAGAAACGG - Intergenic
946114955 2:217453258-217453280 CCATCCAGAGTAGAAATATCTGG - Intronic
948455686 2:238103648-238103670 GCATCCAGGGTTGGAACAGGTGG - Intronic
1169918816 20:10711408-10711430 TCATCCAAGATAGGAATAAATGG + Intergenic
1171356246 20:24547613-24547635 GCATCCTGGGTAGTGATAATTGG + Intronic
1171777479 20:29382565-29382587 GCATCCAGGGGAGACATCACAGG - Intergenic
1174910891 20:54606369-54606391 GCATCCAGGGTAAAAATCAATGG + Intronic
1175584907 20:60131525-60131547 GCATCCAGTGGGGGAATAAAGGG + Intergenic
1175721096 20:61287801-61287823 GCATCCATTGTGGGAATAAGAGG + Intronic
1178329702 21:31677221-31677243 AGATCCAGGGTACAAATAACAGG - Intronic
1178668503 21:34569635-34569657 GGATACAGGGGAGGAACAACTGG + Intronic
1179443267 21:41410978-41411000 GCATCCAGGGCAGGGAGAAGGGG + Intergenic
1180628323 22:17209425-17209447 GCATGCTGGGTGGGAATATCAGG + Exonic
1180727439 22:17956753-17956775 GCATACAGGGCAGGAAGAAGTGG + Intronic
1181669643 22:24420212-24420234 GCATCCTGGGCAGGAACAAAGGG + Intronic
951464180 3:22984256-22984278 GGATGGAGGGAAGGAATAACTGG + Intergenic
956077098 3:65517068-65517090 GCTTCCAGAGTAGGAAAACCTGG - Intronic
961251024 3:125505562-125505584 GCAGCCAGGGTAGGCAAAAAGGG + Intronic
962344761 3:134610932-134610954 GCATCCTTGGGAGGAATAGCAGG - Intronic
967043067 3:185711705-185711727 GCGTCCAGGGAAGGAAAAAGAGG - Intronic
968085943 3:195873920-195873942 GCAGGCAGGGTGGGAATCACAGG - Intronic
971248936 4:24955713-24955735 GAATCCAGGGGAGGAAGAAATGG + Intronic
973798770 4:54455451-54455473 GCCTCCAGAGTAGGGATTACGGG + Intergenic
984540585 4:181032479-181032501 GCATCAAGGTTAGGAAGAAATGG - Intergenic
992357423 5:76000356-76000378 ATATCCCAGGTAGGAATAACAGG - Intergenic
1002278445 5:178117712-178117734 GCATCCAGGTAAGGAATCACAGG - Intronic
1003567379 6:7232003-7232025 GAAGCCAAGCTAGGAATAACTGG - Intronic
1004622658 6:17344620-17344642 GCATTCAAAGTAGGAATAAGAGG + Intergenic
1007823499 6:44579805-44579827 CCATCCAAGGTAGGAAAAAGTGG - Intergenic
1011217501 6:85020408-85020430 GCTTCCAGGGAAGGAATTGCAGG + Intergenic
1015750463 6:136553349-136553371 GGAGCCAGGGCAGGAAGAACAGG - Intergenic
1016257895 6:142130931-142130953 GCCTCCAGAGTAGGGACAACAGG + Intergenic
1017448667 6:154532733-154532755 GAATCCAGTATAGGAATGACAGG + Intergenic
1017677560 6:156829366-156829388 GCATCCAGGGTCGGACTCCCGGG + Exonic
1021000718 7:15327409-15327431 GCAGCAAGTGTAGGAATGACTGG + Intronic
1021741611 7:23691524-23691546 GCAGCCATGGGAGGATTAACTGG + Exonic
1023693456 7:42818799-42818821 GCAGAAAGGGTAGGAAGAACAGG + Intergenic
1026408259 7:70091215-70091237 GCATCCAGGGGAAAAATGACAGG - Intronic
1027278171 7:76583720-76583742 GCATTCACAGGAGGAATAACTGG + Intergenic
1027837189 7:83259645-83259667 GAAACCAGGGTAGGGAGAACAGG - Intergenic
1030380185 7:108802437-108802459 TCATCCAGATAAGGAATAACTGG + Intergenic
1031060553 7:117046551-117046573 GAACACAGTGTAGGAATAACAGG - Intronic
1032521709 7:132550446-132550468 TCTTCCAGGCTAGGATTAACAGG + Intronic
1035109006 7:156464693-156464715 GCATCCAAGGAAGGGAAAACCGG + Intergenic
1035316970 7:158002509-158002531 GCATGCAGTGAAGGAACAACGGG + Intronic
1036190095 8:6662346-6662368 GAATCCAGGGTAGGAAAAGCAGG - Intergenic
1037215109 8:16440881-16440903 GCTTCCAGGATAGGACTAATGGG - Intronic
1044573977 8:93748789-93748811 GCATCCAGGGAAGGAAAATAAGG + Intergenic
1045296306 8:100874401-100874423 CCCTCCAGGGTAGGACTACCAGG - Intergenic
1045948201 8:107821374-107821396 TCATCCTGGGAAGGAATAAGGGG - Intergenic
1050292111 9:4165833-4165855 GCATACAGGGGATGAAGAACAGG + Intronic
1051130438 9:13854096-13854118 TCATCCAGGATAGGAATATGAGG - Intergenic
1054413676 9:64850793-64850815 GCATCCAGGGGAGACATCACAGG - Intergenic
1060812306 9:126616663-126616685 GCCTCCAGGGAAGGAAAAGCTGG + Intronic
1192639311 X:72847299-72847321 GAATACAGGGTGGGAATAGCTGG + Intronic
1192642400 X:72873506-72873528 GAATACAGGGTGGGAATAGCTGG - Intronic
1193070803 X:77303685-77303707 CCATCCAGGGGATGAAGAACAGG + Intergenic
1194067372 X:89277755-89277777 GTGTCCAGGATAGGAATAAGGGG - Intergenic
1200721530 Y:6611964-6611986 GCATCCAGGATAGGAATAAGGGG - Intergenic