ID: 1113154031

View in Genome Browser
Species Human (GRCh38)
Location 13:107297440-107297462
Sequence CTTCCATTTCTACAAGTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113154031 Original CRISPR CTTCCATTTCTACAAGTTAA AGG Intronic
901612677 1:10511551-10511573 CCTCCATCTCTAGAAGTTATAGG - Intronic
902126888 1:14221907-14221929 CTTCCCTTTCATCAAGTAAATGG - Intergenic
903943264 1:26946115-26946137 CTTCCGTTTCTCCAGGTTCATGG + Exonic
904059873 1:27700424-27700446 TTTCCTTTACTACAAGTAAAAGG + Intergenic
905073606 1:35249805-35249827 CTTCCATTGCTACATGTAAGTGG + Intergenic
905352762 1:37359006-37359028 CTTCAGTTTCTACAAGATGAGGG - Intergenic
906233783 1:44190032-44190054 CTTCCATTTTCAAAATTTAAAGG - Intergenic
908859754 1:68470807-68470829 CTTTCTTTTCTCCAACTTAATGG - Intergenic
911077568 1:93892787-93892809 CTTCCTTTCCTACTAGTAAAAGG + Intronic
913113405 1:115675903-115675925 CTTCCATTTCTAAAATTTTGAGG + Intronic
918343179 1:183583820-183583842 CTTCCATGACTGCAAGATAAAGG - Intronic
920874823 1:209825179-209825201 TGTGCATTTCTAAAAGTTAAGGG - Intergenic
921423623 1:214977159-214977181 CCTGCATTTCTAGAAGTTGAGGG - Intergenic
921544176 1:216454496-216454518 CTTCTGTTGCTCCAAGTTAATGG - Intergenic
922413341 1:225396943-225396965 TTTGCATTTATATAAGTTAAGGG + Intronic
923312241 1:232746397-232746419 CATCCATTTCTAAAATTTTAAGG + Intergenic
923893398 1:238240474-238240496 CTTCCTTTTCTACAAGAGATTGG - Intergenic
1063620960 10:7648404-7648426 CTTCAATGTGTACAATTTAATGG - Intronic
1063777634 10:9282318-9282340 CTTCCATCTTTATAATTTAATGG + Intergenic
1068104607 10:52598307-52598329 CTTCAATTTCTACATCTTTATGG + Intergenic
1068656273 10:59579114-59579136 CAGCCTTTTCTACAAGGTAAAGG + Intergenic
1069027019 10:63553707-63553729 CATCCGTCTCTACAAATTAAAGG - Intronic
1070428204 10:76309675-76309697 CTTGCATTGCAACAAGTTAGGGG + Intronic
1073375823 10:103033586-103033608 CATCCGTCTCTACAACTTAAAGG + Intronic
1075522650 10:123152970-123152992 CTTCTCTTTCCACAAGTTAATGG - Intergenic
1088385693 11:109252949-109252971 TTTTCATTTGTACAAATTAATGG + Intergenic
1088437722 11:109833925-109833947 CTACCATTCCTACCAGTTATTGG - Intergenic
1089051136 11:115547149-115547171 TCTCCATTTCTACAAATTACAGG - Intergenic
1090058294 11:123441942-123441964 CTTGCACTTCTAGAAGGTAAGGG + Intergenic
1090492710 11:127179164-127179186 CTTTCAGTTTTAGAAGTTAATGG + Intergenic
1090545721 11:127765466-127765488 CTTCCATTTCTAATATTAAATGG - Intergenic
1090785322 11:130043139-130043161 CTTACCTTTCCTCAAGTTAATGG + Intergenic
1092256719 12:6929961-6929983 CAGCCATTTCTACAAGGTCAGGG - Intronic
1094412423 12:30181029-30181051 ATTTTATTTTTACAAGTTAATGG - Intergenic
1095541602 12:43315049-43315071 ATACCATTACTACAATTTAATGG + Intergenic
1095715049 12:45335075-45335097 TATCCATTCCTAAAAGTTAATGG + Intronic
1095993675 12:48059411-48059433 TTTTCATTTCTAGAAGTTCAAGG + Intronic
1096060387 12:48693492-48693514 CTTCCAGTTCTACTCGTAAAAGG - Exonic
1098738415 12:74137732-74137754 TTACCATTTCTACCAGTTTATGG + Intergenic
1099029441 12:77506851-77506873 CTACTGTTTCTACAAGTCAATGG - Intergenic
1099056935 12:77854241-77854263 CTTCCAGTTCTAGAAACTAATGG - Intronic
1103503342 12:121422660-121422682 CTTCCCTTTCTACAGGTCAGAGG - Intronic
1103639806 12:122341016-122341038 CTTCCATTTCTACGAGATGCTGG + Exonic
1103859680 12:124002420-124002442 CTTACATTTTTAAAAGATAAGGG + Intronic
1104120163 12:125791260-125791282 CTTCCCTTTCTACCACTTAGAGG - Intergenic
1111768371 13:92564216-92564238 TTTCCATTTCTGCAGGTAAATGG + Intronic
1112623098 13:101072260-101072282 ATTGCATTTTTACAAGTTGAAGG - Intronic
1113154031 13:107297440-107297462 CTTCCATTTCTACAAGTTAAAGG + Intronic
1115360695 14:32498104-32498126 ATTCCATTTCTACAATGTTATGG + Intronic
1115598733 14:34935000-34935022 CTTCTATTTTTACAAGTCATAGG - Intergenic
1116495341 14:45553195-45553217 CTCTCCTTTCTACAAGTGAAAGG + Intergenic
1116586245 14:46708401-46708423 CCTCCATTTCTTCAAGTAAAAGG + Intergenic
1116867697 14:50044573-50044595 CTTCCATTTCTTCATGTTAGGGG - Intergenic
1119466275 14:74861403-74861425 CTTCCATTTACTCATGTTAAAGG + Intronic
1120514348 14:85452631-85452653 CTTCAATTGCTGCAAGTTTATGG + Intergenic
1123830325 15:24129555-24129577 ATTCCCTTTTTACAAGTCAATGG - Intergenic
1123860350 15:24459964-24459986 ATTCCCTTTTTACAAGTCAATGG - Intergenic
1123863982 15:24498585-24498607 ATTCCCTTTTTACAAGTCAATGG - Intergenic
1124158692 15:27250314-27250336 CTTACATTTAATCAAGTTAAAGG + Intronic
1124464629 15:29925733-29925755 CTTCCATTTTTACAGCTTTATGG + Intronic
1124869770 15:33529005-33529027 CTTATATTATTACAAGTTAATGG - Intronic
1126630104 15:50725732-50725754 ATTCCATTTCTAGAAGATATGGG - Intronic
1127206233 15:56722359-56722381 ATTGCATTTTTACAAGTTGAAGG - Intronic
1128145938 15:65332584-65332606 CTTTCATTTGGACAGGTTAACGG + Intronic
1128434541 15:67632994-67633016 CTTCCAGTTCTACAATTCTATGG - Intronic
1130826647 15:87554366-87554388 GTTTCATTTCTACAAATTTATGG + Intergenic
1131868683 15:96738904-96738926 CTTCCATGTCCACAGGTTCAGGG + Intergenic
1133505940 16:6412370-6412392 CTTCCGTTTCTACCTTTTAAAGG + Intronic
1133901289 16:9977506-9977528 CTTTCATTTCTACACATAAAGGG - Intronic
1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG + Intronic
1135996487 16:27253298-27253320 CATCAAATCCTACAAGTTAAAGG - Intronic
1139069766 16:63365819-63365841 TTTCCATTTTTACAAAATAAAGG + Intergenic
1140044123 16:71429172-71429194 CTTCCACTTCTACCAGCTCAAGG - Intergenic
1140286662 16:73609374-73609396 CTTCCATTTCAAAAAAATAAAGG + Intergenic
1147185522 17:38711294-38711316 CCCCCCTTTCTTCAAGTTAAGGG + Intronic
1149227846 17:54496461-54496483 TTTCCTTTTCTAGCAGTTAAAGG + Intergenic
1150327629 17:64269449-64269471 CTTCCACTTCTGCTATTTAAGGG - Intergenic
1152969105 18:144059-144081 CTGGCTTTTCTAAAAGTTAATGG + Intergenic
1154352473 18:13596864-13596886 ATTACATTTCTACATGTTATTGG + Intronic
1155557767 18:27040291-27040313 CTTCCATTTGGACCATTTAAAGG - Intronic
1158156603 18:54432748-54432770 TTACCATTTCTGCAAGTTAAAGG - Intergenic
1159297560 18:66515649-66515671 TATCAATTTCTACAAGTTAATGG - Intronic
1160298993 18:77661848-77661870 CATCCATTTTTACATGATAAAGG - Intergenic
1164520902 19:28978614-28978636 GTTCCATTTTTACATGTTGATGG - Intergenic
1167391437 19:49197524-49197546 CTTCCATCCCTCCAAGCTAAGGG + Intronic
928251390 2:29684408-29684430 CTTCCATTTCTAAAAGGGCAGGG + Intronic
928715890 2:34059983-34060005 CTTCCTTTTGTACTAGTTAGTGG + Intergenic
930519796 2:52450110-52450132 ATTCCATTTCTAAAAATAAAAGG + Intergenic
933227986 2:79773046-79773068 CTTCCAATTCTGGAAGTAAATGG - Intronic
935075515 2:99739402-99739424 TTTCCATTTCTACAGCTTCATGG + Intronic
935257334 2:101322616-101322638 CTTCCATTTCCTCAAGTTTGTGG + Intergenic
935588114 2:104820261-104820283 GTTCCAATCCTACCAGTTAAAGG - Intergenic
935860875 2:107328021-107328043 CATCCATTTCAACAATTTATAGG - Intergenic
936724491 2:115296437-115296459 CTTCCTTTTCTAGTGGTTAAAGG - Intronic
937295622 2:120808198-120808220 CTTCCATTTCTAGAATTGCAGGG - Intronic
937555806 2:123153859-123153881 CTTGCATTTCTACAAGTGTATGG - Intergenic
937717499 2:125050504-125050526 CTGCTATTTCTACAACTTGAAGG + Intergenic
942569126 2:177295514-177295536 CTTCCTTCTCTACAAGATGAGGG - Intronic
943118233 2:183701680-183701702 CTTCCATCTCTACATATTAAAGG - Intergenic
944357069 2:198803231-198803253 CCTCCTTTCCTACAGGTTAAGGG + Intergenic
944587454 2:201185226-201185248 CTTCCCTTTCTGTAAGATAAAGG + Intronic
944849517 2:203704029-203704051 CTTCCTTCTCTGCAAGATAAGGG + Intergenic
945559417 2:211320338-211320360 CTAACATGTCTACAAGTTATGGG + Intergenic
948798089 2:240416046-240416068 ATTAAATTTCTACAAGTTATAGG - Intergenic
1169952405 20:11059940-11059962 TTTCCTTATCTACAAATTAATGG + Intergenic
1170053497 20:12173066-12173088 CTTCCATTTCTATCCCTTAAAGG - Intergenic
1173144359 20:40511839-40511861 CTTACATCTCAACAAGTCAAAGG + Intergenic
1176902285 21:14457222-14457244 CTTGTACTTCTACATGTTAATGG + Intergenic
1177399971 21:20590950-20590972 ATTACATTTCTAAAAGTTATAGG + Intergenic
1181878506 22:25958825-25958847 ATCCCATTTCTATAAGATAAGGG + Intronic
949398267 3:3638116-3638138 CTTCCATTTATGCAAGGAAAAGG + Intergenic
951354947 3:21654530-21654552 CTTCCTTTTCTACATGTAAATGG + Intronic
954043435 3:47908234-47908256 CTACCATTTCTAAATCTTAAAGG + Intronic
959164950 3:102765052-102765074 CTTTCCTTTCTTCATGTTAAAGG - Intergenic
961974938 3:131013805-131013827 GTTCCATTTCAGCAAGTTAATGG - Intronic
962635200 3:137324122-137324144 CTACCATTTATATAAGTGAAGGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964346451 3:155759021-155759043 CTTCCATTTTTACAAGGCGAGGG + Intergenic
964377125 3:156058956-156058978 CTTCCAACTCTAGAAGTCAAAGG + Intronic
965776936 3:172241699-172241721 CTTGCATTTCTACATGTTGTGGG - Intronic
966121186 3:176522366-176522388 CTTCACTCTCTACAAGTAAATGG + Intergenic
967305644 3:188056486-188056508 CTCTCATTTCTCCAAGCTAAGGG - Intergenic
967555045 3:190847139-190847161 CTTCTATTTCTGCCAGATAAAGG - Intergenic
968717403 4:2170911-2170933 AGTACTTTTCTACAAGTTAAAGG + Intronic
970163951 4:13216479-13216501 CTTCTGTATCTACAAGTGAAAGG - Intergenic
970258733 4:14200004-14200026 CTTCCATTACTCAAAGTTACAGG - Intergenic
971581514 4:28347467-28347489 CTTCTATTTCTAGAAGTCTAAGG + Intergenic
971596526 4:28535924-28535946 CTTCCATATTTAAAAGTTCATGG - Intergenic
971655990 4:29345181-29345203 CTTATAGTTCTACAGGTTAATGG - Intergenic
971673739 4:29596663-29596685 AATCCATTTCTCCAGGTTAAGGG + Intergenic
976770490 4:88647037-88647059 CTTACATTTTTGCAAGGTAAAGG - Intronic
977963329 4:103110951-103110973 CTGCCACCTCCACAAGTTAAGGG + Exonic
978468321 4:109032938-109032960 CTTTCATTTATACAATTTCAGGG - Intronic
979520371 4:121659428-121659450 CTTTCAATTCTAAAAGTTTAAGG + Intergenic
980220414 4:129906218-129906240 ATTCCAATTATACAATTTAATGG + Intergenic
980453586 4:133008943-133008965 TTTACATTTCTAAAAGTAAAGGG - Intergenic
980470725 4:133248199-133248221 ATTCCATTCCTAGAAGTAAAGGG - Intergenic
984445947 4:179835896-179835918 CATACATTTCTACAAATTAGTGG + Intergenic
985363402 4:189200188-189200210 GTTTCATTTCTACAAATGAACGG + Intergenic
986157944 5:5195719-5195741 CTTGCATTTCCCCAAGTTTATGG + Intronic
986728964 5:10620808-10620830 CTTACATTTCTCCATTTTAAAGG + Intronic
988546100 5:32158985-32159007 CTTCCAATTTCACAAGATAATGG + Intronic
990328908 5:54706041-54706063 CTTCCAGTTTTACAACTTGAGGG + Intergenic
991515945 5:67435652-67435674 TTTGCATTTCTACAACTAAAGGG - Intergenic
991615397 5:68491962-68491984 ATAGCATTTCTTCAAGTTAATGG - Intergenic
992190039 5:74283220-74283242 CTTTCTTTTCTACAAATTAGTGG - Intergenic
992273866 5:75094090-75094112 ATTACATTTCTATAAGTTATAGG - Intronic
992510551 5:77429473-77429495 CTGCCTTTTCTACAAATTGAGGG + Exonic
992970497 5:82051809-82051831 CATCCATTTTTTAAAGTTAAAGG - Intronic
994050232 5:95354057-95354079 CTTCCATTTGAACAACTTAGTGG - Intergenic
994587815 5:101733201-101733223 ATTCCATTTCTACCTGTCAATGG - Intergenic
994765681 5:103914062-103914084 CTTCCATTTTTATAATTTTATGG - Intergenic
995902660 5:117088511-117088533 TTTCCATGTCAACAATTTAAAGG - Intergenic
997379130 5:133422650-133422672 CTTCCATTTCTACATCTCCAGGG - Intronic
997796648 5:136817425-136817447 CTTCCATTCCTACTAATTCAGGG + Intergenic
997969686 5:138391076-138391098 CTTCCACTTCCAAAAGTCAAAGG - Exonic
999509666 5:152235933-152235955 CCTCTATTTCTTCAAGTGAAAGG - Intergenic
999785262 5:154884599-154884621 CTGCTATTTCTGGAAGTTAAAGG + Intergenic
1002284510 5:178153444-178153466 TTTGCATTTCTAAACGTTAACGG - Intronic
1002525350 5:179812576-179812598 CTTCCATGTCCAGAAGTCAATGG - Intronic
1003204376 6:3993525-3993547 CATCCACCCCTACAAGTTAAAGG - Intergenic
1003398924 6:5775725-5775747 CTTCCCATTCTCCAAGTGAAAGG + Intergenic
1006981229 6:38149876-38149898 CTTCCCTTTCTTCAAGATATTGG - Intronic
1007936227 6:45734745-45734767 CTTTCATTTCTCCAAGTTTCTGG - Intergenic
1008447933 6:51614962-51614984 CTAACATTTCCTCAAGTTAATGG - Intergenic
1010065469 6:71677595-71677617 CTTCCATTTGTACATGGTGAAGG - Intergenic
1010350357 6:74866769-74866791 CTTCTATTTCTTAAAGTTCATGG + Intergenic
1011966726 6:93167756-93167778 CTTACATTTCTAAAAGTAAAAGG + Intergenic
1012693366 6:102346520-102346542 GTTCCATTTCTGCAAGTTTTGGG - Intergenic
1014193423 6:118524485-118524507 CTTCCACTTCCACAAGGTAATGG - Intronic
1015461032 6:133491624-133491646 CTTCCATCTCTACTTGTTATTGG - Intronic
1015685587 6:135855944-135855966 CTTCCATTTCTTCATCTTTAAGG + Intronic
1016186039 6:141198460-141198482 CTTCCATTTCTCTGTGTTAAAGG + Intergenic
1016258194 6:142135431-142135453 GTTCAATTTCTTCAAGTTAATGG - Intergenic
1018891044 6:167982551-167982573 ATTACATTTCTACATGTTACAGG - Intergenic
1019317507 7:395396-395418 ATTACATTTCTACATGTTATAGG + Intergenic
1020768818 7:12360943-12360965 CTGCCATTTCAAAATGTTAAAGG + Intronic
1021471779 7:21011288-21011310 CTTCCATGTCTTCAAGTGAGAGG - Intergenic
1023771668 7:43562271-43562293 CTTCCATTTCTATCATTGAAGGG + Exonic
1024463796 7:49686706-49686728 TTTACATTTCTAACAGTTAAAGG + Intergenic
1025247871 7:57331087-57331109 CTCCCGTTTCCACCAGTTAAGGG + Intergenic
1027392766 7:77722119-77722141 CTTCCAATTCTCTATGTTAATGG - Intronic
1027413203 7:77944445-77944467 CTTCCCTTACTACAGGTTTAGGG + Intronic
1028465496 7:91146934-91146956 ATTCTATTTCTACAATTTTATGG + Intronic
1030503790 7:110393916-110393938 TTACCATATCAACAAGTTAAAGG + Intergenic
1032765480 7:134987712-134987734 CTTCAATTTCAAAGAGTTAAAGG - Intronic
1033442104 7:141389420-141389442 CTTCCATTTGTACAGCCTAAAGG + Intronic
1035937535 8:3858485-3858507 CTTCCATTTCTACAAATGGTTGG - Intronic
1035946319 8:3967346-3967368 GTTCCATGTTTACAAGTTCAGGG - Intronic
1037660919 8:20926178-20926200 CTTGCCCTCCTACAAGTTAAGGG - Intergenic
1037667373 8:20981659-20981681 CATCCATTCCCACAAGTTAAGGG - Intergenic
1039275238 8:35927642-35927664 ATTCCAGTTCCACAAGTTCAGGG + Intergenic
1041568438 8:59307818-59307840 CTTCTATTTCCACATCTTAAAGG + Intergenic
1042013626 8:64281336-64281358 CTTTCTTTTCTAAATGTTAAAGG + Intergenic
1042405388 8:68399166-68399188 ATTTCATTTCTATAAGTTTATGG + Intronic
1043516649 8:81000997-81001019 CTTCCATTTCTAAAGGAAAAAGG + Intronic
1047410072 8:124617286-124617308 CTTCCATTTCTAGGAGATCAAGG + Intronic
1050719630 9:8571703-8571725 CTTCCATTTGTTCATTTTAAGGG + Intronic
1050793578 9:9506944-9506966 ATTCTATTTCTAGAAGTTAAAGG + Intronic
1051083159 9:13316620-13316642 CTCCCATTTCTAGAAGTTCCTGG - Intergenic
1051788432 9:20772197-20772219 CTACCATTTCTCAAAGTGAATGG - Intronic
1052977123 9:34419494-34419516 ATTCCAGTTCTTCAAGATAAGGG + Intronic
1056191275 9:84186622-84186644 ATTGCATTTCTACAAATTGAAGG + Intergenic
1060338259 9:122748531-122748553 CTTTCATTTGTATAAGTTTATGG + Intergenic
1060769681 9:126323320-126323342 CTTCCATTTCAAAAATTTCATGG + Intergenic
1060948224 9:127583102-127583124 ATTCCATTTATAGAAGTTATTGG - Intergenic
1185798968 X:2992151-2992173 ATTACATTTCTCCACGTTAAAGG + Intergenic
1186006028 X:5072994-5073016 CTTGCATTTCTACAAATTTGAGG + Intergenic
1186256235 X:7723771-7723793 CTTCTATTTCTAAACCTTAATGG - Intergenic
1186271994 X:7898875-7898897 CTTAAATTTCTTCAATTTAAGGG + Exonic
1186919136 X:14258604-14258626 CATACATTTCTTCAAGTTATAGG - Intergenic
1187060929 X:15786702-15786724 CTTTCTAATCTACAAGTTAAAGG - Exonic
1188008186 X:25032135-25032157 CTGCCATTTCTAAAAAATAATGG + Intergenic
1188359991 X:29241363-29241385 CATCCTTTTAAACAAGTTAAAGG + Intronic
1191891551 X:65947896-65947918 ATTACATTTCTATAAGTTAAAGG + Intergenic
1192223404 X:69212387-69212409 CTTCCATTTCTTCCACTGAAAGG - Intergenic
1193194472 X:78614526-78614548 TTTGTATTTCTACAAGTTATTGG + Intergenic
1193860384 X:86658793-86658815 CATTTATTTCTACAAGTAAATGG - Intronic
1195281199 X:103335047-103335069 TTTCCATTTCTAAAAGCTATTGG - Intergenic
1196035220 X:111136591-111136613 CCTCCATTTCTAGAAGGTAATGG - Intronic
1197667279 X:129237588-129237610 CTTCCACTGCTACCAGTTATTGG + Intergenic
1197822197 X:130552733-130552755 CTTCTATTTCAAAAGGTTAAAGG - Intergenic
1198315172 X:135458340-135458362 TTTCAATTTCTACAAGAAAAAGG + Intergenic
1198864371 X:141105754-141105776 CTTCCATATTTCCAATTTAACGG - Intergenic
1198898318 X:141481662-141481684 CTTCCATATTTCCAATTTAACGG + Intergenic
1198921790 X:141737216-141737238 CTTCCATCTCTACATTTTGATGG - Intergenic
1198944747 X:141998091-141998113 ATTCCATTTGCAAAAGTTAAAGG + Intergenic
1199058481 X:143326113-143326135 AATACATTTCTACATGTTAAGGG - Intergenic
1201013937 Y:9578954-9578976 CTTCCATATTTCCAATTTAATGG - Intergenic