ID: 1113157823

View in Genome Browser
Species Human (GRCh38)
Location 13:107345184-107345206
Sequence GTCTTCCAATGCAAGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 871
Summary {0: 1, 1: 0, 2: 6, 3: 138, 4: 726}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113157823 Original CRISPR GTCTTCCAATGCAAGAACAA AGG (reversed) Intronic
900672265 1:3862238-3862260 GTTTTCCAATCCATGAACATGGG - Intronic
900863301 1:5248725-5248747 GTCTTCCAATTCATGAACATGGG + Intergenic
902265934 1:15264250-15264272 GTCTTCCAATTCTTGAACATGGG + Intronic
902919559 1:19657837-19657859 GTCTTCCAAGGCCAGAAGGAGGG + Exonic
903089544 1:20899467-20899489 CTCTTCCAATGCCAGTAAAAGGG + Intronic
903505102 1:23828286-23828308 GTCTTCCAATTCATGAACATGGG - Intronic
904116499 1:28165840-28165862 GTCTTCCAATCCATGAACTTGGG - Intronic
905267671 1:36765937-36765959 GTCTTTGAACCCAAGAACAATGG + Intergenic
905288077 1:36898558-36898580 GTCTTCCAGTCCATGAACATGGG - Intronic
905903753 1:41601367-41601389 TTCTTCCAATCCATGAACACAGG + Intronic
906682137 1:47735341-47735363 GTCTTCCCATTCAGGAACATGGG + Intergenic
906863082 1:49383159-49383181 GTTTTCCAATCCATGAACATGGG - Intronic
907596435 1:55724604-55724626 GTCTTCCAAAGGCAAAACAAAGG + Intergenic
907642765 1:56207960-56207982 GCCATCCCATGCAACAACAAGGG - Intergenic
907877799 1:58511000-58511022 GTCTTACAATCCATGAACATGGG - Intronic
907950294 1:59176886-59176908 GTCTTCCAATCCATAAACACAGG + Intergenic
908366699 1:63431633-63431655 GTCTTCCAATGAACAAACACAGG + Intronic
908635991 1:66165766-66165788 GTCTTCCAATCCACTAACATAGG - Intronic
909690842 1:78406215-78406237 TTCTTCCAATCCATGAACAAGGG - Intronic
909783577 1:79581669-79581691 TTCTTCCAATCCATGAACACTGG + Intergenic
910045747 1:82913038-82913060 GTCTTCCAATCCATAAACATTGG + Intergenic
910574535 1:88745614-88745636 GTCTTCCAATTCATGAACACAGG - Intronic
910603838 1:89061063-89061085 GTCTTCCAATCCATAAACACAGG - Intronic
911266239 1:95747336-95747358 GTCTTCCTATCCATGAACATGGG + Intergenic
911398794 1:97348283-97348305 GTCTGACAAAGCAATAACAAGGG + Intronic
911771761 1:101752042-101752064 TTCTTCCAATCCATGAACATGGG + Intergenic
911774164 1:101786724-101786746 GCCATCCCATGCAACAACAAGGG - Intergenic
912190650 1:107335958-107335980 GACTTCCAATCCATGAACATAGG - Intronic
912342132 1:108927169-108927191 GTCTTCTAATCCATGAACATGGG - Intronic
912636035 1:111294182-111294204 GTCTTCCAACTCATGAACATGGG + Intronic
912784578 1:112587928-112587950 GTCTCCCAATCCATGAACATGGG + Intronic
912878846 1:113389992-113390014 GTCTTCCAATCTAAGCACACCGG + Intergenic
913373580 1:118127717-118127739 TTCTTCCAATCCATGAACAAAGG + Intronic
913720784 1:121591947-121591969 GTGTTCCAATCCATGAACACTGG - Intergenic
914234719 1:145798778-145798800 GTCTTCCAATCCATGAACACAGG + Intronic
914381372 1:147119430-147119452 GTCTCCCAATGCATGGAGAAAGG - Intergenic
914383986 1:147149683-147149705 GTCTTCCAATCCATGAATATGGG - Intergenic
915042133 1:152977453-152977475 TTCTTCCTATGAAAGAAAAAGGG - Intergenic
915178082 1:154033864-154033886 TTCTTCCAATCCATGAACATGGG + Intronic
915405448 1:155656616-155656638 TGCTTCAAATGCAAGAAAAATGG - Intergenic
915853829 1:159358798-159358820 TTCTTCCAATCCATGAACACGGG - Intergenic
915998726 1:160593150-160593172 TTCTTCCAATCCATGAACATGGG + Intergenic
916187968 1:162151608-162151630 TTCTTCCAATCCATGAACATGGG + Intronic
916468673 1:165099357-165099379 TTCTTCTAATGCATGAACATGGG - Intergenic
916914556 1:169392122-169392144 GTCTTTCAATACATGAACACAGG - Intronic
916918179 1:169433323-169433345 GTCCTCCAATCCATTAACAAGGG - Intronic
916976045 1:170079886-170079908 GTCTTCCAATCTATAAACAAGGG + Intronic
917643120 1:177002721-177002743 TTCTTCCTATGCCAGTACAATGG - Intronic
917826492 1:178827180-178827202 TTCTTCCAATGCACAAACACAGG - Intronic
917852161 1:179074073-179074095 ATCTTTCAATGCAAGAAAACTGG - Exonic
918155238 1:181838730-181838752 GTCTTCCAATTCATGAACATGGG - Intergenic
918234518 1:182566746-182566768 GTCTTTCAATCCATGAACATAGG + Intergenic
918272691 1:182918530-182918552 ATCTTCCAATCCATGAACATGGG - Intronic
918489399 1:185064697-185064719 GTCTTCAAATCCATGAACATGGG + Intronic
918707062 1:187677050-187677072 GTCTTCCAATCCATAAACATGGG + Intergenic
919444657 1:197688194-197688216 GTCTTCCAATTCATGAACATGGG - Intronic
919507180 1:198413781-198413803 TTCTTCCAATCCATGAACACAGG + Intergenic
919514402 1:198503880-198503902 GTCTTCCAATCCAAGAACATGGG + Intergenic
919936872 1:202257926-202257948 GTCTTCCAATCCATGAATATGGG + Intronic
920104284 1:203539939-203539961 GTATAGCAATTCAAGAACAATGG + Intergenic
921042257 1:211444529-211444551 GTCTTCCAATCCATGAACATGGG - Intergenic
921885179 1:220298152-220298174 GTCTTCCAATAAGAGAAGAATGG - Intergenic
922378282 1:224992332-224992354 TTCTTCCAATCCATGAACATAGG + Intronic
922569033 1:226622198-226622220 GTCTTCCAATCCATGAACATGGG + Intergenic
923138926 1:231143747-231143769 TTCTTCCAATCCATGAACATGGG - Intergenic
923428762 1:233898948-233898970 ATCTTCCAATCCATGAACATGGG + Intergenic
1063014766 10:2064740-2064762 GTCTGACAATGCAATAAAAAAGG - Intergenic
1063802691 10:9598418-9598440 GTCTCACAATGAAAGAATAAAGG + Intergenic
1064172324 10:13044904-13044926 GTCTTCCAATTCATGAGCATTGG + Intronic
1064503142 10:15996607-15996629 GTCTTCCAATCCCAGAACACAGG + Intergenic
1064680294 10:17805005-17805027 GTCTTCCATTTCATGAACACAGG + Intergenic
1064880933 10:20052883-20052905 GTCTTCCATTTCAAGAAGGAGGG - Intronic
1064943712 10:20764107-20764129 GTCTTCCAGTCCATGAACATAGG - Intergenic
1065056608 10:21850489-21850511 GTATTCCAATACATGAACATGGG - Intronic
1065070419 10:22018424-22018446 GTCTTCCAATCCATGAACACAGG - Intergenic
1065098919 10:22314445-22314467 GTGTTCTAATGCTAGAAAAACGG - Intergenic
1065758212 10:28954803-28954825 ATCTTCCAATTCATGAACATGGG - Intergenic
1065941702 10:30570433-30570455 GTCTTCCTATCCATGAACATGGG + Intergenic
1066154935 10:32665814-32665836 TTCTTCCAATCCAGGAACATGGG + Intronic
1066161661 10:32738878-32738900 TTCTTCCAATGCAAGGATACTGG + Intronic
1067086876 10:43246287-43246309 GTCTTACAATCCATGAACATGGG - Intronic
1067320350 10:45214009-45214031 GTCTTCCTATTCATGAACATGGG - Intergenic
1067678686 10:48411728-48411750 GTCTTCCAATTCACAAACATAGG + Intronic
1068223580 10:54076074-54076096 GTCTTCCCATCCATGAACATGGG + Intronic
1068692152 10:59927943-59927965 GTCTCCCAATCCACGAACATAGG - Intergenic
1069039590 10:63681507-63681529 GTCTTCCATTCCCAGAAGAATGG + Intergenic
1069053851 10:63823225-63823247 TTCTTCCAATCCATGAACATGGG - Intergenic
1069088333 10:64168677-64168699 GTCTTCCAATTCATGAACACAGG + Intergenic
1069320410 10:67164000-67164022 GTCTTCCAGTTCATGAACACAGG - Intronic
1069541978 10:69301739-69301761 GTCTTCCAATCCATGAACATGGG - Intronic
1069586737 10:69610530-69610552 GTCTTCCTATCCATGAACATGGG - Intergenic
1070059667 10:72969492-72969514 GTCTTCCAGTCCATGAACACAGG + Intergenic
1070244158 10:74714352-74714374 TTATTCCGATGCATGAACAAAGG + Intergenic
1070468682 10:76754193-76754215 TTATTCCAATGCATGAACATAGG - Intergenic
1070482239 10:76893863-76893885 GTCTTCTAATCCAGGAACATGGG - Intronic
1070898055 10:80002544-80002566 GTCTTCCAATCCATAAACATGGG - Intergenic
1071002717 10:80848713-80848735 TTCTTCCAATCCATGAACATGGG - Intergenic
1071833933 10:89400389-89400411 GTCTTCTAATCCACGAACAAAGG + Intronic
1072137060 10:92556997-92557019 GTCTTCCCATCCATGAACATGGG - Intronic
1072142162 10:92598706-92598728 GTCTTTCAGTTCATGAACAAGGG + Intronic
1072366013 10:94710494-94710516 GTCTTCCAATAGATGAACATGGG + Intronic
1073569710 10:104567981-104568003 TTCTTCCAATCCATGAACATAGG + Intergenic
1074091005 10:110255694-110255716 GTCTTCCAATCCATGAGCACAGG - Intronic
1074177742 10:111027478-111027500 TTCTTCCAATCCATGAACACAGG + Intergenic
1074408853 10:113206218-113206240 TTCTTCCAATCCATGAACATTGG - Intergenic
1074594762 10:114851813-114851835 GTTTTCCAATTCATGAACACCGG + Intronic
1075010856 10:118869095-118869117 TTCTACAAATGCAAAAACAAAGG + Intergenic
1076627085 10:131828543-131828565 TTCTTCCAATCCACGAACATGGG + Intergenic
1076800298 10:132819277-132819299 TTCTTCCAATCCATGAACACAGG - Intronic
1076920309 10:133448992-133449014 TTCTTCCAATTCATGAACATAGG - Intergenic
1077427207 11:2487485-2487507 GTCTTCTAATCCATGAACATGGG + Intronic
1077449344 11:2627037-2627059 GCCTTCCAATCCATGAACATAGG + Intronic
1077682310 11:4253688-4253710 TTCTTCCAATCCATGAACAGAGG + Intergenic
1077692891 11:4364238-4364260 TTCTTCCAATCCATGAACAGAGG - Intergenic
1078504592 11:11925026-11925048 GTCTTCCAGTTCATGAACAGAGG + Intronic
1078611710 11:12825538-12825560 GTCTTCCAATCCATGAACATGGG - Intronic
1079878767 11:25896180-25896202 GCCTTCCAATATAAGAACATTGG + Intergenic
1079954568 11:26846868-26846890 TTCTTCCAATGCAAAATCCATGG - Intergenic
1081327786 11:41767158-41767180 GTCTTCTAATTCATGAACACAGG + Intergenic
1082097406 11:48142457-48142479 GTCTTCCAATCCATGAGCATGGG + Intronic
1082206249 11:49437917-49437939 GTCTTCCAATCTGTGAACAAGGG + Intergenic
1082701519 11:56437696-56437718 GTCTTCCAATCCATGAACATGGG + Intergenic
1083002334 11:59304687-59304709 TTCTTCCAATCCATGAACATAGG + Intergenic
1083030411 11:59586431-59586453 GTCTTCCAATCTATGAACATAGG - Intronic
1083338507 11:61942892-61942914 GTCTTCCAATCCATGAACATAGG - Intergenic
1084802062 11:71550750-71550772 GTCTTCCAATACATGAACATAGG - Intronic
1084843811 11:71883118-71883140 GTCTTCCAATTCATGAACATAGG - Intronic
1085885600 11:80518210-80518232 GTCTTACAATGTAATAATAATGG + Intergenic
1085942996 11:81228379-81228401 GTCTTCCAACACATGAACACTGG + Intergenic
1086102501 11:83116045-83116067 GTCAGCCAATGGAAGAACAGTGG + Intergenic
1086354040 11:85974059-85974081 TTCTTCTAATGCAACAATAATGG + Intronic
1086430803 11:86734386-86734408 GTCTTCCAGTCCATGAACATAGG - Intergenic
1086579394 11:88380577-88380599 GTCTTCCAATCCATAAACATGGG - Intergenic
1086649018 11:89263867-89263889 GTCTTCCAATCTGTGAACAAGGG - Intronic
1086791837 11:91049324-91049346 TTCTTCCAATCCATGAACATGGG - Intergenic
1087053924 11:93913551-93913573 GTCTTCCAATCCATGAGCATGGG + Intergenic
1087079512 11:94156331-94156353 GTCTTCCACTGCCAGAAAGAGGG - Intronic
1087090344 11:94264333-94264355 GTCTTCCAGTTCATGAACATAGG + Intergenic
1087174493 11:95083537-95083559 GTTTTCCAATGCAATAGCAGTGG - Intergenic
1087700033 11:101426050-101426072 TTCTTCCAATTCATGAACACAGG + Intergenic
1087988944 11:104723392-104723414 TTCTTCCAATCCATGAACATGGG + Intergenic
1088085149 11:105969224-105969246 GACAACCAATGCAAGAATAAAGG + Intronic
1088180852 11:107108364-107108386 TTCTTCCAATCCATGAACATGGG - Intergenic
1088341399 11:108772012-108772034 ATCTTTACATGCAAGAACAATGG - Intronic
1088556647 11:111068410-111068432 TTCTTCCAATCCATGAACATGGG + Intergenic
1089851811 11:121504008-121504030 GCCTTCCAATGCATGGACAAAGG + Intronic
1089877289 11:121736698-121736720 GTCTTCCAAACCATGAACATGGG + Intergenic
1090679397 11:129037545-129037567 GTCTTCTAATCCCTGAACAAGGG - Intronic
1091040311 11:132272490-132272512 GCCTTCCAATTCATGAACATGGG + Intronic
1091329250 11:134717786-134717808 GTCTGGCACTGCAATAACAATGG + Intergenic
1091940312 12:4473918-4473940 TTCTTCCAATCCATGAACACAGG - Intergenic
1092439687 12:8488523-8488545 TTCTTCCAATCCATGAACACAGG - Intergenic
1093304086 12:17490669-17490691 GTCTTCCAATCCAAATAAAATGG - Intergenic
1093360038 12:18213790-18213812 TTCTTCCAATTCATGAACATAGG - Intronic
1093535948 12:20223354-20223376 TTCTTCCAATCCACGAACATGGG - Intergenic
1093738544 12:22653470-22653492 GTTTTCCAATCCATGAACATGGG + Intronic
1095136247 12:38607789-38607811 GTCTTCCAATACATAAACATGGG - Intergenic
1095522924 12:43088688-43088710 GTCTCCCAATCCATGAACATGGG + Intergenic
1095668012 12:44825224-44825246 TTCTTCCAATCCATGAACACAGG + Intronic
1095883377 12:47163045-47163067 GTCTTTCAATCCATGAACATGGG + Intronic
1096325057 12:50652737-50652759 GTCTTCCAGTCCATGAACACAGG + Intronic
1096346037 12:50847569-50847591 GTCCTCCAATCCATGAACACAGG - Intronic
1096357916 12:50958105-50958127 GCCTTCCAATTCAGGAACACAGG - Intronic
1096900516 12:54874932-54874954 GTCTTCCAATTCATAAACACAGG - Intergenic
1097206854 12:57329786-57329808 GTCTTCCAATCCATGAACATGGG + Intronic
1097298744 12:57996022-57996044 GTCTTCCAATCCATGAACATAGG + Intergenic
1097609473 12:61801144-61801166 TTCTTCCAATTCATGAACATGGG - Intronic
1098249398 12:68553383-68553405 GCCATCCCATGCAACAACAAGGG - Intergenic
1098427101 12:70377034-70377056 GTCTTCCTATCCAGGAACAAAGG - Intronic
1098520867 12:71434002-71434024 TTCTTCCAATCCATGAACATGGG - Intronic
1098557068 12:71831216-71831238 GTCTTCCAACCCATGAACACAGG + Intergenic
1098564587 12:71918813-71918835 GTCTCACAAAGGAAGAACAAAGG - Intronic
1098609614 12:72439415-72439437 CTCTTCCAATCCATGAACATGGG + Intronic
1098658309 12:73060710-73060732 GTCTTCCAATCCAGCAACATTGG + Intergenic
1098823604 12:75265467-75265489 TTCTTCCAATCCATGAACATAGG - Intergenic
1098870069 12:75807410-75807432 GTCTTCCAATTCATAAACATGGG + Intergenic
1098944916 12:76579325-76579347 GTCTTCCAATCCATGAACATGGG - Intergenic
1098962966 12:76758284-76758306 TTCTTCCAATCCATGAACACAGG - Intergenic
1099587651 12:84541323-84541345 TTCTTCCAATTCATGAACATGGG + Intergenic
1099688378 12:85919133-85919155 GTCTTCCAATTAAAGAATATAGG + Intergenic
1099828259 12:87807020-87807042 TTAGTCCAGTGCAAGAACAAGGG + Intergenic
1100495266 12:95118966-95118988 GTCTTCTAATTCCAGAGCAAGGG - Intronic
1100782267 12:98040955-98040977 TTCTTCCAATCCATGAACATAGG - Intergenic
1100968613 12:100042134-100042156 ATCTTCCAATCCATGAACAGTGG - Intronic
1101217555 12:102599828-102599850 GTCTTAGAATCCAAGAACTAGGG - Intergenic
1101310005 12:103569142-103569164 GACTTCCAATACAAGAGCATGGG - Intergenic
1101366148 12:104072480-104072502 GTCTGCCAATTCATGAACATGGG + Intronic
1101644059 12:106612222-106612244 GTCTTCCAGTCCATGAACACAGG + Intronic
1101766293 12:107702711-107702733 GTCTTCTAATACATGAACATGGG + Intronic
1102033259 12:109756071-109756093 GTCTTCCAATCCATGAATACAGG + Intronic
1102326049 12:111985559-111985581 GTCTTCCAATCCATGAACATGGG - Intronic
1103135644 12:118505064-118505086 GTCTTCCAATCCATGAACATGGG + Intergenic
1103378546 12:120476131-120476153 GTTTTTCAATGCAACAAAAAAGG + Intronic
1103584812 12:121944497-121944519 GTCTTCCAATCCATGAGCATGGG + Intronic
1103766136 12:123281379-123281401 GTCTTCCAATCCATGAACACAGG + Intergenic
1103793651 12:123488826-123488848 TTCTTCCCACCCAAGAACAAGGG + Intronic
1104085251 12:125468712-125468734 GTCTTTCAATTCATGAACATGGG + Intronic
1104769549 12:131352524-131352546 GTTTTCCAAGGAAAGAACACTGG - Intergenic
1105499796 13:20961788-20961810 GCCATCCCATGCAACAACAAGGG + Intergenic
1106063466 13:26319586-26319608 ATCTTCCAATTCATGAACATAGG - Intronic
1106341577 13:28834048-28834070 GTCTTCCAGTCCATGAACACAGG - Intronic
1106365833 13:29080011-29080033 GACTTCCAATCCATGAACATGGG + Intronic
1106830625 13:33578027-33578049 TTCTTCCAATCCATGAGCAAGGG - Intergenic
1107471010 13:40691183-40691205 TTCTTCCAATCCATGAACATGGG - Intergenic
1108392424 13:49959481-49959503 GCCTTCCAATCCATGAACATGGG + Intergenic
1108439267 13:50433028-50433050 TTCTTCCAACCCATGAACAAGGG + Intronic
1108796641 13:54039552-54039574 GTCTTCCAATCCATAAACATAGG - Intergenic
1108910279 13:55541229-55541251 GTCTTCTAATCCATGAATAAGGG - Intergenic
1109051310 13:57485415-57485437 GTCTTCCAATCCATGAACAGAGG - Intergenic
1109176016 13:59156565-59156587 TTCTTCCAATACATGAACACAGG - Intergenic
1109321193 13:60811991-60812013 GTCTTCCAAAGCCTGAGCAAAGG + Intergenic
1109421940 13:62124876-62124898 ATTTTCCAAAGGAAGAACAAAGG - Intergenic
1109741290 13:66559333-66559355 GGCTTCCAATACAACATCAAAGG - Intronic
1109792404 13:67267204-67267226 GACATCCCATGCAACAACAAGGG - Intergenic
1110134854 13:72053715-72053737 GTCTTTCAATCCATGAACACAGG + Intergenic
1110241882 13:73276938-73276960 GTCTTCCAATCCATGAACACAGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110674030 13:78218153-78218175 GTCTTTCAATGCAATAGCATAGG - Intergenic
1110808594 13:79788198-79788220 TTCTTCCAATCCATGAACATGGG + Intergenic
1111104980 13:83633082-83633104 GTGTTCGAATGCAAGAATAGAGG + Intergenic
1111480371 13:88816396-88816418 GTCATCCAATACATGAACACGGG - Intergenic
1111490455 13:88966485-88966507 TTCTTCCAATCCATGAACACAGG + Intergenic
1111619460 13:90704956-90704978 ATCTTCCAATCCATGAACATGGG + Intergenic
1111789866 13:92840718-92840740 GTCTTCTAATTCATGAACATGGG + Intronic
1112438921 13:99411210-99411232 TTCTTCAAATGCAAATACAATGG - Intergenic
1112564241 13:100538836-100538858 GTCTTCCAATCCATGAACATGGG + Intronic
1112874378 13:104017528-104017550 GTCTTGAAAGGCAAAAACAAAGG - Intergenic
1113157823 13:107345184-107345206 GTCTTCCAATGCAAGAACAAAGG - Intronic
1113256029 13:108506276-108506298 GTCTTCCAATCCATGAATACAGG + Intergenic
1114988226 14:28255927-28255949 GTCTTACAATTCATGAACATGGG - Intergenic
1115484233 14:33894282-33894304 CTCTTCCAATACATGAACATGGG - Intergenic
1117210055 14:53487667-53487689 TTCTTCCAATCCATGAACACAGG - Intergenic
1117236637 14:53784198-53784220 GTCTTCCAATCCACCAACATGGG + Intergenic
1117477626 14:56112787-56112809 GTCTTCCAATCCATGAACATCGG - Intergenic
1117828279 14:59726208-59726230 GTCTTCAAATGCAAGAAAAATGG - Intronic
1118103827 14:62636012-62636034 GTTTTCCAGTGCATGAACACAGG - Intergenic
1118729276 14:68655215-68655237 CTCTCTCAATGCAGGAACAAGGG + Intronic
1118826743 14:69390102-69390124 GTCTTCCAACTCATGAACATGGG - Intronic
1118944104 14:70367096-70367118 TTCTCCCCCTGCAAGAACAAAGG + Exonic
1118986195 14:70757149-70757171 GTCTTCCAATTCATGATCATGGG - Intronic
1119375839 14:74192087-74192109 ATCTTCCAATGCAAGATAAATGG - Intronic
1119550573 14:75509790-75509812 GTCTTCCAATCCATGAACAAGGG - Intergenic
1119810638 14:77515400-77515422 ATCTTCCAATCCATGAACACAGG + Intronic
1120173143 14:81266502-81266524 GTCTGATGATGCAAGAACAAGGG - Intronic
1120276516 14:82381243-82381265 GTCTTCCAATCCATGAACATGGG - Intergenic
1120300020 14:82694021-82694043 GTCCTCCAATGCCAGATCAAAGG - Intergenic
1121042884 14:90763857-90763879 GTCTTCCAATCCATGAACATGGG - Intronic
1121167543 14:91820976-91820998 ATCTTCCAATCCATGAACATGGG - Intronic
1122170258 14:99867445-99867467 GTCTTCCAATCCATAAACATAGG + Intronic
1122359002 14:101146770-101146792 GTCTTTCAATACAGGAACATGGG + Intergenic
1122431146 14:101646161-101646183 GCCTTCCAATCCATGAACATGGG - Intergenic
1122752336 14:103946914-103946936 GTCTTCCAATCCATGAATAGAGG - Intronic
1124106950 15:26747342-26747364 GTCTTCCAATTCATGAAAACGGG + Intronic
1124162024 15:27279868-27279890 ATCTTCCAATCCATGAAAAAAGG + Intronic
1125700597 15:41679424-41679446 GTCTTCCTATTCATGAACATGGG + Intronic
1125829201 15:42701356-42701378 TTCTTCCAATCCATGAACATGGG + Intronic
1126303975 15:47233545-47233567 GTCTTCCAATGTATGAATATGGG + Intronic
1126861363 15:52886063-52886085 GCCATCCCATGCAACAACAAGGG + Intergenic
1126881038 15:53098028-53098050 TTCTTCCAATCCATGAACATGGG + Intergenic
1127137283 15:55937697-55937719 TTCTTCCAATCCATGAACACAGG - Intronic
1127337605 15:58004905-58004927 GTCTTCTAATCCATGAACATGGG - Intronic
1127763146 15:62160534-62160556 TTCTTCCAATCCATGAACACAGG - Intergenic
1127851591 15:62917394-62917416 GTCTTTCAATCCATGAACATGGG - Intergenic
1128006245 15:64244408-64244430 TTCTTCCAATCTATGAACAAGGG - Intronic
1128128283 15:65208947-65208969 GGCTACAAATGCAGGAACAAAGG - Intronic
1128859714 15:71057321-71057343 ATCTTCCAATCCATGAACATGGG + Intergenic
1128872545 15:71173396-71173418 GTTTTCCAATTCATGAACATGGG - Intronic
1129571791 15:76694208-76694230 TTCTTCCAATCCATGAACACAGG + Intronic
1129638170 15:77344675-77344697 GTCTTCCAACCCATGAACATGGG + Intronic
1130010126 15:80145608-80145630 GTCTTCCAATCTATGAACATGGG - Intergenic
1130092751 15:80834872-80834894 GTCTTCCAATTCATGAAGATAGG + Intronic
1131886505 15:96920770-96920792 GTCTTCCAATGCATAAACATGGG + Intergenic
1132118369 15:99155323-99155345 GTTTTTCTATCCAAGAACAAGGG - Intronic
1133006990 16:2888566-2888588 GTCTTCCAATCCATGAACATGGG + Intronic
1133684505 16:8153446-8153468 GTCTTCCAGTCCATGAACACAGG + Intergenic
1133862228 16:9606878-9606900 GTTTTCCAATGCAAGAGAGATGG - Intergenic
1134037322 16:11040861-11040883 GACTTACAATGCATTAACAAAGG + Intronic
1134362812 16:13547743-13547765 TTCTTCCAATTCATGAACATGGG - Intergenic
1134769065 16:16789289-16789311 GTCTTTCAATCCATGAACATGGG + Intergenic
1134810126 16:17160413-17160435 GTCATCCAATGAGAGAACAGGGG - Intronic
1134863334 16:17581095-17581117 ATCTTCCAATCCATGAACACTGG - Intergenic
1134915409 16:18066052-18066074 TTCTTCCAATCCATGAACATGGG - Intergenic
1135168400 16:20161100-20161122 TTCTTCCAATCCATGAACATAGG + Intergenic
1135636656 16:24082237-24082259 GTCTTTCAATCCATGAACATGGG - Intronic
1135902964 16:26483186-26483208 GTCTTCCAAGCCATGAACATGGG - Intergenic
1136017582 16:27412605-27412627 GTCTTCCAATCCATGATCATGGG + Intronic
1137297008 16:47104405-47104427 GTCTTCCCATTCATGAACACAGG - Intronic
1137297597 16:47111151-47111173 GTCTTCCAATGGAAGGTCACTGG + Intronic
1137689838 16:50415831-50415853 GTCTTCCAATCCATGAACACAGG + Intergenic
1137998801 16:53251926-53251948 GTCTTCCCATCCATGAACATGGG - Intronic
1138580619 16:57938533-57938555 GACTTCCAAATCAAGAAAAAAGG - Intronic
1138800486 16:60021512-60021534 TTTTTCCAATCCAAGAACACTGG - Intergenic
1138838368 16:60466482-60466504 TTCTTCCAATTCATGAACACAGG - Intergenic
1139074383 16:63425830-63425852 GTCATCCAATGTATGAACATGGG + Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1139813584 16:69646072-69646094 ATTTTCCAATGTAAGAACAATGG - Intronic
1139960235 16:70713438-70713460 TTCTTCCAATTAAAGTACAAAGG + Intronic
1140030173 16:71329901-71329923 CTCTTCCAATCCATGAACATGGG - Intergenic
1140125739 16:72117123-72117145 GTCTTTCAATCCATGAACATGGG + Intronic
1140319969 16:73941025-73941047 GCCATCCCATGCAACAACAAGGG - Intergenic
1140334081 16:74087158-74087180 CTCTTCCAATTCATGAACATGGG + Intergenic
1140403060 16:74687312-74687334 GTCTTCCTATTCAAGAACATGGG - Intronic
1141043911 16:80697924-80697946 TTCTTCCAATCCATGAACATGGG - Intronic
1141258765 16:82431213-82431235 TTCTTCCAATCCATGAACATGGG - Intergenic
1142437269 16:90068887-90068909 GTCTTCAAATCCACGAACACAGG - Intronic
1143254935 17:5549062-5549084 GTCTTCCAATCTATGAACATGGG + Intronic
1144033757 17:11345587-11345609 GTCTTCCAATCCATGAACGTGGG + Intronic
1144935498 17:18894986-18895008 GTCTTCCTATCCATGAACATGGG + Intronic
1145084807 17:19928283-19928305 TTTTTCCAAAGCTAGAACAAAGG + Intronic
1145853469 17:28127606-28127628 GTCTTCCAATCCATTAACATGGG - Intronic
1146747031 17:35340747-35340769 TTCTTCCAATCCATGAACATGGG + Intergenic
1146750095 17:35370844-35370866 TTCTTCCAATCCATGAACATGGG - Intronic
1146839586 17:36141353-36141375 GTCTTTCATTCCAAGAGCAAAGG - Intergenic
1147855928 17:43479891-43479913 GTCTTAAAATGCAAGAGAAATGG + Intergenic
1148286095 17:46393662-46393684 GTCTTCCAAGCCATGAACACAGG - Intergenic
1148308262 17:46611252-46611274 GTCTTCCAAGCCATGAACACAGG - Intronic
1148447803 17:47750141-47750163 GTCTTTCTATGCATGAACATGGG + Intergenic
1149717152 17:58802651-58802673 TTCTTCCAATCCATGAACACAGG + Intronic
1149910842 17:60565451-60565473 GCCATCCCATGCAACAACAAAGG - Intronic
1150545115 17:66148473-66148495 GTCTTCCAATCCATGAATACAGG + Intronic
1150678327 17:67263977-67263999 GTGTTCCAACGCAAGATAAAAGG - Intergenic
1150817568 17:68405306-68405328 GTCTTCCAATCCATGAACATGGG + Intronic
1151069468 17:71191948-71191970 TTCTTCCAATTCAAGAATAAGGG + Intergenic
1152384958 17:79967621-79967643 GTCTTCCAATCCATGAACGTGGG - Intronic
1152582853 17:81175314-81175336 GTCTTTCAATCCATGAACATAGG - Intergenic
1153432665 18:5035884-5035906 GTTTTCCAATCCATGAACACGGG + Intergenic
1153754728 18:8269414-8269436 GCCTTCCAATCCATGAACATGGG - Intronic
1153958458 18:10119431-10119453 TTCTTCCAATCCATGAACATGGG - Intergenic
1153987717 18:10368241-10368263 GTCTTCCCATGCAGACACAAAGG - Intergenic
1154982220 18:21512298-21512320 GTCTTCCAATCCATAAACACAGG + Intronic
1155104749 18:22651760-22651782 GTCTTCCACTCCATGAACATGGG + Intergenic
1156080532 18:33328916-33328938 GTCTTCCAATTCATGAATACAGG + Intronic
1156166998 18:34433697-34433719 TTCTTCCCATTCATGAACAATGG + Intergenic
1156625226 18:38900520-38900542 TTCTTCCACTCCAAGCACAATGG + Intergenic
1156827813 18:41453468-41453490 GTCTTCCAGTTCATGAACATGGG - Intergenic
1158149015 18:54345441-54345463 GTCTTCCAGTACATGAACATAGG - Intronic
1158262046 18:55617547-55617569 GTCTTCCAATCCATGAATATGGG + Intronic
1158650832 18:59283666-59283688 TTCTTCCAATTCATGAACACAGG + Intronic
1158747863 18:60222331-60222353 TTTTTCCAATCCAAGAACATGGG + Intergenic
1158827730 18:61242491-61242513 GTCTTCCAAGGCAAGGAAATCGG + Intergenic
1159715140 18:71812270-71812292 GTCTTCCAATCCATGACCACAGG - Intergenic
1159979295 18:74756432-74756454 GTGTTCCAATGCATGAACATGGG + Intronic
1162243170 19:9374496-9374518 TTCTTCCAATCCATGAACACTGG + Intronic
1162669176 19:12240053-12240075 GTCTTACAATCCATGAACATGGG - Intronic
1162686310 19:12387662-12387684 GTCTTCAAAAGCCAGAACAATGG - Intronic
1162690628 19:12427185-12427207 GTCTTCAAAAGCCAGAACAATGG - Intronic
1163060462 19:14757248-14757270 GTCTTCCAATCCATGAACATAGG - Intronic
1163192606 19:15688485-15688507 TTCTTCCAATCCATGAACATGGG - Intronic
1163219492 19:15905050-15905072 TTCTTCCAATCCATGAACATGGG + Intergenic
1163539888 19:17901934-17901956 GTCTTCTAATTCATGAACATGGG + Intergenic
1164287163 19:23827639-23827661 GCCATCCCATGCAACAACAAGGG + Exonic
1164518942 19:28962366-28962388 GTCTTCCAAACCAGGAACATGGG - Intergenic
1165581514 19:36869000-36869022 GTCTTCTAATCCATGAACATGGG + Intronic
1167139757 19:47641819-47641841 GTATTCCAATCCATGAACATGGG + Intronic
1167407489 19:49322744-49322766 GTCTTCCAACCCATGAACATGGG - Intronic
925250418 2:2431387-2431409 GTCTTCCTATTCATGAACATGGG - Intergenic
926262296 2:11276540-11276562 GTCTTCCAGTCTAATAACAAGGG - Intronic
926333188 2:11842386-11842408 GTTTTCCAAAGCAGGAAGAATGG - Intergenic
926347802 2:11964898-11964920 GTCTTCCAAACCATGAACACAGG + Intergenic
926565712 2:14470205-14470227 GTCTTCCAATCCACGAACATGGG + Intergenic
927011126 2:18905556-18905578 GTCTTCCAATCTATGAACATAGG + Intergenic
927350793 2:22111634-22111656 GTCTTCCAATTCATAAACACAGG - Intergenic
927802491 2:26114107-26114129 GTCTTCCAATTCACAAATAATGG - Intronic
928004585 2:27552701-27552723 ATATTCCAATCCATGAACAAGGG + Intronic
928376524 2:30778900-30778922 TTCCTCCAATGCAAGAAAGAGGG + Intronic
928502317 2:31909636-31909658 TTCTTCCAATCCATGAACATGGG - Intronic
928916310 2:36475211-36475233 GTCTTTCAATCCATGAACACGGG + Intronic
929569633 2:43013695-43013717 GTCTTCCAATCCATGAACACAGG + Intergenic
929833930 2:45376844-45376866 GTCTTCCAATCCATGAACATGGG - Intergenic
930662836 2:54072201-54072223 GTCTTCTAATTCATGAACATGGG - Intronic
930956997 2:57215331-57215353 TTCTTTCAATCCATGAACAAAGG - Intergenic
931192131 2:60013763-60013785 GTCTTCCAATTCATGAACACAGG - Intergenic
931423181 2:62146854-62146876 GCCATCCCATGCAACAACAAGGG + Intronic
931519153 2:63076371-63076393 GTCTTCCAACTCATGAACATTGG + Intergenic
931567958 2:63636231-63636253 TTCTTCCAATCCATGAACATGGG - Intronic
932270944 2:70408993-70409015 GTCTTTCAATTCATGAACATGGG - Intergenic
932382192 2:71294775-71294797 CTCTTCCAATTCATGAACATGGG + Intronic
932833765 2:75015116-75015138 TTCTTCCAATTCATGAACATAGG - Intergenic
932992305 2:76802493-76802515 TTCTTCCAATCCATGAACACAGG - Intronic
933382353 2:81565495-81565517 GTCTTCCAATCCACGTACACAGG - Intergenic
933623305 2:84569858-84569880 CTATTCCAATGCAACAACATAGG - Intronic
933712538 2:85337668-85337690 GTCTTCCAATCCATGAATATAGG - Intergenic
933807054 2:86006471-86006493 TTCTTCCAATCCATGAACATTGG - Intergenic
934776591 2:96942232-96942254 GTCTTCCAATCCATGAACATGGG - Intronic
935357533 2:102217284-102217306 TTCTTCCAATTCATGAACAAAGG - Intronic
936039314 2:109137760-109137782 GTCTTTGAACGCAAAAACAACGG - Intronic
936239468 2:110774695-110774717 GTCTTCCAATTCATGAACATAGG - Intronic
936723927 2:115289331-115289353 TTCTTCCAATGCATGAGCATGGG - Intronic
937068693 2:119044054-119044076 TTCTTCCAATTCATGAACACAGG + Intergenic
937184334 2:120025662-120025684 GTCTTCAAATTCATGAACATGGG - Intronic
937722416 2:125117925-125117947 GTCTTTCAATACAGGAACATGGG - Intergenic
937752863 2:125498937-125498959 ATCTTCCAATCCATGAACACAGG + Intergenic
937791092 2:125962668-125962690 GTCTTCCAATGCATGAGTCATGG + Intergenic
937899680 2:127009623-127009645 GTCTTCCAATCCACAAACATGGG + Intergenic
937931358 2:127207851-127207873 GTCTTCCAGTCCATGAACATGGG - Intronic
937991922 2:127668192-127668214 GTTTTCCAATCCATGAACATGGG - Intronic
938129497 2:128700257-128700279 TTCTTCCAATGCATGAACGCAGG - Intergenic
938136260 2:128759659-128759681 ATCTTCCAATTCATGAACATGGG + Intergenic
938394567 2:130933540-130933562 GTCTTCAAATCCATGAACACTGG + Intronic
938677234 2:133650238-133650260 GTCTTCCAATCCATAAACATAGG - Intergenic
940803865 2:158162976-158162998 GTCTTCCAATCTATGAACATAGG - Intergenic
940981415 2:160007765-160007787 GTCTTCCAAGGCATGAACACGGG - Intronic
941088765 2:161149106-161149128 GTCTTCCAATCCATGGACATAGG + Intronic
942250474 2:174043483-174043505 GCCATCCAATGCAACAACAAGGG + Intergenic
942469235 2:176242584-176242606 GTCATCCCATGCAACAACAAGGG + Intergenic
942652682 2:178184834-178184856 TTCTTCCAATCCATGAACACAGG - Intergenic
943237621 2:185342699-185342721 GTCTTCCAATCCATAAACACAGG - Intergenic
943667157 2:190621491-190621513 GTCTTCCAACCCATGAACATAGG - Intergenic
944073306 2:195697345-195697367 GTCTTCCAATCCGTGAACATGGG + Intronic
944099421 2:196006980-196007002 GTCTTTCAATTCATGAACACAGG - Intronic
944103894 2:196058711-196058733 GTCTCCCAATCCATGAACATGGG - Intronic
944372850 2:199006691-199006713 TTCTTCCAATCCATGAACATAGG + Intergenic
945103969 2:206290464-206290486 GTCTTCCAATCCATGAATAGAGG + Intronic
945289629 2:208114462-208114484 GTCTTCCAATCCATTAACATAGG - Intergenic
945462505 2:210126339-210126361 GTCTTCCAATCCATGAATATGGG - Intronic
945823391 2:214691507-214691529 GTCTTCCAATTTATGAACATAGG - Intergenic
946121265 2:217516954-217516976 TTTTTCCAATGCATGAACACAGG - Intronic
947071881 2:226297271-226297293 GTCTTCCAATCCACGAACATTGG - Intergenic
947448995 2:230188103-230188125 TTCTTCCAATCCATGAACATGGG + Intronic
947466219 2:230349480-230349502 GTCTTCCAATCCATGAACATGGG + Intronic
947474755 2:230433608-230433630 GTCTTTCAATCCATGAACATTGG + Intronic
948133944 2:235621678-235621700 AAGTTCCAATGCATGAACAATGG - Intronic
948322058 2:237078329-237078351 GTCTCCCAATCCATGAACAAGGG + Intergenic
1169161877 20:3387038-3387060 GTCTACCAATGCATGAACAGAGG - Intronic
1169183037 20:3587670-3587692 GTCTTGCAAAATAAGAACAAAGG - Intronic
1169310715 20:4537140-4537162 TTCTTCCAATTCATGAACATGGG - Intergenic
1169810020 20:9600462-9600484 GTCTTCCAATGTATGAACAGAGG + Intronic
1169833144 20:9847432-9847454 GTCTTCCAATCTATGAACATGGG - Intergenic
1169891432 20:10456848-10456870 GTCTTACAATCCATGAACACGGG + Intronic
1170072519 20:12383760-12383782 GTCTTGCAATGCAGGAATGAAGG - Intergenic
1170777176 20:19386035-19386057 TTCTTCCAATGCATGAACACAGG + Intronic
1171176688 20:23056059-23056081 GTCTTCCAATCCATGAACGTAGG - Intergenic
1171187664 20:23134419-23134441 GTCTTCCAATTCATGAACAAAGG - Intergenic
1171193304 20:23177518-23177540 GTCTTCCAATCCATGAACATGGG - Intergenic
1171478120 20:25429435-25429457 ATCTTCCAATCCATGAACATGGG + Intronic
1172655498 20:36534451-36534473 GTCTTCCAATCCGTGAACAGTGG - Intergenic
1172875807 20:38163828-38163850 GTCTTCCATGGGAACAACAATGG - Intronic
1175170665 20:57078497-57078519 GTCTTCCAATACATGAGCATGGG + Intergenic
1175984477 20:62757659-62757681 ATCTTCCAATCCATGAACATGGG + Intronic
1176174501 20:63712933-63712955 GTCTTCCAATTCATGAATGAAGG + Intronic
1176367446 21:6042139-6042161 GTTTTCCAATTCATGAACATGGG + Intergenic
1177259423 21:18710908-18710930 CTCTTCCTATCCAAGAACATGGG - Intergenic
1177759351 21:25385334-25385356 GTGTTTTAATGCAAGACCAAAGG - Intergenic
1178004292 21:28198885-28198907 TTCTTCCAACCCAAGAACATGGG - Intergenic
1178896046 21:36558401-36558423 GTCTTCTAATCCATGAACATGGG + Intronic
1179087517 21:38231034-38231056 CTCTTCCAATCCATGAACATGGG + Intronic
1179756072 21:43496407-43496429 GTTTTCCAATTCATGAACATGGG - Intergenic
1179900029 21:44386619-44386641 GGCTTCCAATTCATGAACATGGG - Intronic
1180073006 21:45447538-45447560 GTCTTCCAATCCATAAACATGGG - Intronic
1180153232 21:45963373-45963395 GTCATCCTATCCAAGAGCAAGGG - Intergenic
1180964807 22:19782270-19782292 GTTTTCCAATCCATGAACATGGG + Intronic
1180975654 22:19846622-19846644 GTCTTCAAATGTAAGTACTAGGG - Exonic
1181374329 22:22443770-22443792 GTTTTCCAATAAATGAACAAAGG - Intergenic
1181455307 22:23056272-23056294 GTCTTCTAATCCATGAACATGGG + Intergenic
1182581611 22:31316149-31316171 GTCTTCCTATGCATGTACCATGG - Intergenic
1182657490 22:31902346-31902368 GATTACCAAAGCAAGAACAAGGG - Intronic
1182708140 22:32301542-32301564 GTATTCCAATCCATGAACATAGG - Intergenic
1182916051 22:34031827-34031849 TTCTTCCAATCCATGAACATCGG + Intergenic
1183339125 22:37268854-37268876 TTCTTCCAATCCATGAACATGGG - Intergenic
1183713131 22:39518391-39518413 GTCTTCCAAAGGCAGAACTAGGG - Intergenic
1184395843 22:44239020-44239042 GTGTTCCAATCCATGAACATAGG - Intergenic
1184494733 22:44832072-44832094 GTCTTCCAATCCATGAACATGGG + Intronic
1184899945 22:47439787-47439809 CTCATGCAATGAAAGAACAAAGG - Intergenic
1185412406 22:50690724-50690746 GTCTTCCAATTAATGAACATGGG + Intergenic
949133285 3:531973-531995 GTCTTCCAATCCATGAACATTGG - Intergenic
949442705 3:4099976-4099998 TTCTTCCAATCCATGAACATGGG - Intronic
949617786 3:5773954-5773976 GTCTTCCAATCCATGACCATGGG + Intergenic
950519735 3:13490457-13490479 GTCTTTCAATCCATGAACATGGG + Intronic
950593907 3:13961161-13961183 TTCTTCCAATCCATGAACCATGG + Intronic
950732615 3:14974501-14974523 GTCTTTCAATCCATGAACACAGG + Intronic
950910178 3:16581191-16581213 TTCTTCCAATCCATGAACATGGG - Intergenic
951175738 3:19597552-19597574 GTCTTCCAATCCATGAGCATGGG + Intergenic
951423514 3:22515783-22515805 TTCTTCCAATCCATGAACATGGG - Intergenic
951435032 3:22652304-22652326 TTCTTCCAATTCATGAACATGGG + Intergenic
951596860 3:24327847-24327869 GTATTCTACTGCTAGAACAAAGG + Intronic
952311109 3:32191217-32191239 GCCATCCCATGCAACAACAAGGG + Intergenic
952735373 3:36685472-36685494 GTCTTCCAATTCATGAACATAGG - Intergenic
953104798 3:39866704-39866726 TTCTTCCAATCCAAGAACATAGG - Intronic
953988621 3:47465789-47465811 GTCTTCCAATCCATGAACGTGGG + Intronic
954095534 3:48324103-48324125 GTCTTCCAATCCATGAAGATGGG + Intronic
954557149 3:51526908-51526930 GTCTTTCAATCCATGAACACAGG + Intergenic
954741614 3:52756065-52756087 GTCTTTCAATCCATGAACATGGG - Intronic
954862493 3:53702452-53702474 GTCTTCCAAAGCAAGACTATGGG - Intronic
955254715 3:57318985-57319007 GTCTTCCAATCCATGAACATGGG + Intronic
955946765 3:64202372-64202394 GTCTGCCAATCCATGAACACAGG + Intronic
956300677 3:67769202-67769224 GCCTTCCAATCCATGAACAGAGG + Intergenic
957602841 3:82360167-82360189 ATCTTCCATTGCAATAAAAAAGG + Intergenic
957745431 3:84334991-84335013 TTCTTCCAATCCATGAACATGGG + Intergenic
957751754 3:84428254-84428276 GTCTTCCAATCCAAGAACATAGG - Intergenic
957817614 3:85322341-85322363 GTCTTCCCATGCAAAACCTAGGG + Intronic
958795929 3:98706296-98706318 GTTTTCCAATGTTAGGACAAAGG + Intergenic
959561327 3:107786191-107786213 GTCCTCCAATCCATGAACATGGG - Intronic
959794521 3:110408676-110408698 GTCTTTCAATCCATGAACATAGG + Intergenic
959816759 3:110682674-110682696 GCCATCCCATGCAACAACAAGGG - Intergenic
960218655 3:115076129-115076151 GTCTTCCAATCCATGAACACAGG - Intronic
960633786 3:119762360-119762382 TTCTTCCAATCCATGAACACAGG - Intronic
960658816 3:120035595-120035617 GTCTTCCAATTCATGAACATAGG + Intronic
960661472 3:120064537-120064559 GTCTTCCTATCCATGAACACAGG - Intronic
960813586 3:121650195-121650217 GTTTTCCAATCCATGAACATGGG - Intronic
961234066 3:125348628-125348650 GTCTTCTAATCCATGAACATGGG - Intronic
961401455 3:126648246-126648268 ATCTTCCAATCCATGAACATGGG - Intronic
961574974 3:127827546-127827568 GTCTTCCAATCCATGAACATGGG + Intergenic
961946433 3:130694391-130694413 GTATTCCACTGCATGAACATGGG + Intronic
962300394 3:134236451-134236473 GTCTTCCAGTCCATGAACATGGG - Intronic
963362818 3:144297957-144297979 TTCTTCCAATACATGAACATAGG + Intergenic
963823728 3:149928792-149928814 GTCTTCCAATCCATGAATATGGG + Intronic
963840589 3:150101415-150101437 GTCCTCCAATCCATGAACATAGG + Intergenic
963879791 3:150516154-150516176 ATCTTCCAATCCAAGAAAATAGG - Intergenic
964240082 3:154582336-154582358 GTCTTCCAATTCATGAATATGGG - Intergenic
964504383 3:157382708-157382730 GGCTTCAAATGCTAGCACAAAGG - Intronic
966348938 3:179009751-179009773 TTCTTCCAATCCATGAACATGGG - Intergenic
966501998 3:180653021-180653043 TTCTTCCAATCCATGAACACAGG - Intronic
967039852 3:185681459-185681481 GTATTCCAATCCATGAACACAGG - Intronic
968022793 3:195409472-195409494 GTCTTCCAATTCATTAACATGGG - Intronic
968557885 4:1258132-1258154 ATCTTCCAATCCATGAACATGGG + Intergenic
968604602 4:1527684-1527706 GTCTTTCAATCCATGAACATGGG + Intergenic
969082653 4:4631639-4631661 GTCTTCTAATCCATGAACATAGG + Intergenic
969784900 4:9449210-9449232 GTCTTCCAATTCATGAACATAGG - Intronic
970083019 4:12310493-12310515 GTCTTCCAATCTAAGAACATGGG + Intergenic
970388666 4:15584033-15584055 TTCTTCCAATCCATGAACACAGG - Intronic
970821477 4:20220274-20220296 TTCTTCCAATCCATGAACATAGG + Intergenic
970963451 4:21899814-21899836 TTCTTCCAATCCATGAACATGGG - Intronic
970985582 4:22153024-22153046 TTCTTCCAATCCATGAACATGGG - Intergenic
971114847 4:23633066-23633088 GTCTTCCAATCCATGAACACAGG + Intergenic
971803477 4:31323266-31323288 GTCTTCCATTCCATGAACATGGG - Intergenic
971828065 4:31653051-31653073 TTCTTCCAAAGAAAGAACAAAGG + Intergenic
972155783 4:36159760-36159782 GTCTTCCAAAGCAAGTATGATGG - Intronic
972244660 4:37233015-37233037 GTCTTCCAACCCATGAACATAGG + Intergenic
974240720 4:59242892-59242914 GTCTTCCAATCCATGAACATAGG + Intergenic
974287719 4:59891741-59891763 GTGTTCCCAGGCAAGCACAAAGG + Intergenic
974582694 4:63825844-63825866 TTCTTCCAATCCATGAACACAGG + Intergenic
974772015 4:66427945-66427967 GTCTTCCAATCCATGAACATGGG - Intergenic
975223702 4:71844272-71844294 TTCTTCCAATCCATGAACATGGG + Intergenic
975538416 4:75476786-75476808 TTCTTCCAATCCAGGAACACAGG - Intergenic
976166520 4:82261472-82261494 GTCTTCCAATCCATAAACATAGG + Intergenic
976316563 4:83664876-83664898 GTCTTCCAGTGGAAGGGCAAGGG - Intergenic
977629564 4:99226929-99226951 TTCTTCCAATTCATGAACATGGG + Intergenic
977631735 4:99250514-99250536 GTCTTGCCATACAAGAAAAAGGG + Intergenic
977643864 4:99389496-99389518 TTCTTCCAATCCATGAACATGGG - Intergenic
977757652 4:100692330-100692352 TTGTTCCAATGAAAGAAAAAAGG - Intronic
977966520 4:103156114-103156136 GTCTTCTAATCCATGAACATGGG - Intronic
978870458 4:113570149-113570171 TTCTTCCAATCCATGAACAGAGG - Intronic
978933875 4:114352240-114352262 TTCTTCCAATGCACAAACATGGG + Intergenic
979195035 4:117910935-117910957 CTCTTCCAATCCAAGAGCAAGGG + Intergenic
979539671 4:121867044-121867066 TTCTTCCAATCCATGAACATGGG + Intronic
979657058 4:123207806-123207828 GTCTTTCAATCCATGAACACAGG - Intronic
979838595 4:125406611-125406633 GTCTTCCAATGCATGAACTTGGG + Intronic
980168664 4:129260140-129260162 GTCTTCCAACCCATGAGCAAAGG - Intergenic
980420555 4:132554299-132554321 GCATTCCAGTTCAAGAACAATGG + Intergenic
980445221 4:132897226-132897248 TTCTTCCAATTCATGAACATGGG - Intergenic
980759183 4:137206110-137206132 GTCTTCCAAGCCATGAACACTGG + Intergenic
981102189 4:140841395-140841417 TTCTTCCAATCCATGAACATGGG + Intergenic
981212176 4:142120442-142120464 GTCTTCTAATCCATGAACACAGG + Intronic
981256663 4:142669192-142669214 TTCTTCCAATCAAAGAACACAGG - Intronic
981323954 4:143425523-143425545 GCCATCCCATGCAACAACAAGGG + Intronic
981484783 4:145274127-145274149 GTCTTCTAATTCATGAACATGGG + Intergenic
981864423 4:149398478-149398500 ATCTTCCAATCCATGAACACAGG + Intergenic
981868879 4:149462274-149462296 GTTTGCCAATGCAAGAAGAGGGG + Intergenic
981880833 4:149610251-149610273 TTCTTCCAATTCATGAACATTGG - Intergenic
981884582 4:149658595-149658617 TTCTTCCAATTCATGAACATGGG + Intergenic
981907392 4:149937444-149937466 TTCTTCCAATCCATGAACACAGG + Intergenic
981921773 4:150093286-150093308 ATCTTCCAATTCATGAACACAGG - Intronic
982494747 4:156077022-156077044 GTCTTCTGATGCATGAACATAGG + Intergenic
982843837 4:160224594-160224616 GGCTTCCAAAGCCAGAACTATGG - Intergenic
982935562 4:161470709-161470731 GTCTTTCAATTCATGAACATAGG + Intronic
983307521 4:166011272-166011294 GTGTTTCAATTCAGGAACAAGGG + Intronic
983342411 4:166480861-166480883 GTCTTTCAATTCATGAACACAGG - Intergenic
984093082 4:175399493-175399515 GTCTTCCAATACATGAACACAGG - Intergenic
984181452 4:176487780-176487802 ATCTTCCAATCCATGAACACAGG - Intergenic
984287493 4:177751002-177751024 TTCTTCCAATCCACGGACAAGGG + Intronic
984319795 4:178179297-178179319 ATCTTCCAATTCATGAACATGGG - Intergenic
984357861 4:178687232-178687254 CTCTTCCAATGCATGAATAGGGG + Intergenic
984386301 4:179063195-179063217 GCCTTCCAATCCATGAACATGGG - Intergenic
986747012 5:10753815-10753837 CTCTTCTCAGGCAAGAACAAAGG - Intronic
987530235 5:19109149-19109171 GTCTTCCAATTCAGGAACATGGG + Intergenic
987632753 5:20496418-20496440 GTCTGCCAATCCAAAAATAAAGG + Intronic
987718885 5:21609537-21609559 GTCTTCCAATCAATGAACACAGG + Intergenic
987751443 5:22043962-22043984 TTCTTCCAATCCATGAACATGGG - Intronic
987863811 5:23516124-23516146 GTCTTCAAATCCATGAACACAGG + Intronic
988075482 5:26348237-26348259 TTCTTCCAAACCAAGAAAAATGG - Intergenic
988862100 5:35292639-35292661 GTCTTCTAATCCATGAACATAGG + Intergenic
988890823 5:35615428-35615450 TTCTTCCAATTCATGAACATGGG - Intergenic
989393466 5:40926777-40926799 TTCTTCTAATCCATGAACAAGGG - Intronic
990094629 5:52096847-52096869 GTCTTCCAATCCATGAACATGGG + Intergenic
990255092 5:53959810-53959832 GAGTTACAATGCAAGAAGAAAGG - Intronic
991174111 5:63666402-63666424 GTCTTCCAATCCATGAACATAGG - Intergenic
991239121 5:64437125-64437147 TTCTTCCAATCCATGAACATGGG - Intergenic
992144988 5:73837279-73837301 TTCTTCCAATCCATGAACACAGG + Intronic
992257821 5:74939122-74939144 TTCTTCCAATCCATGAACATGGG - Intergenic
992421497 5:76610669-76610691 ATCTTCCAATTCATGAACATTGG + Intronic
993358427 5:86943005-86943027 TTCTTCCAATCCATGAACATGGG + Intergenic
993443475 5:87983137-87983159 GTCTCCCAAAGGAAGAACAAAGG + Intergenic
993620176 5:90158914-90158936 TTCTTCCAATACAAAAAAAAAGG + Intergenic
993892755 5:93493430-93493452 GTCTTACAATTCATGAACATGGG - Intergenic
993915287 5:93737308-93737330 GTCTTCCAATCCATGAACACAGG - Intronic
994198983 5:96951215-96951237 GTCTCCAAATGCAATCACAATGG + Intronic
994444105 5:99850912-99850934 GTCTTCTAATCCATGAACACAGG - Intergenic
994696732 5:103080617-103080639 TTCTTCCAATCCATGAACATGGG + Intergenic
995198958 5:109405306-109405328 GTCTTCCAATTCATGAATACAGG - Intronic
995232809 5:109789090-109789112 CTTTGCTAATGCAAGAACAATGG - Intronic
995305697 5:110646113-110646135 GTTTTCCAATCCATGAACACAGG - Intronic
995553835 5:113307264-113307286 GTCTTCCAATCCATGAACATAGG + Intronic
996028174 5:118674704-118674726 GTCTTCCAATCCATGAACATGGG + Intergenic
996270697 5:121601474-121601496 TTCTTCCAATCCATGAACATGGG + Intergenic
996623809 5:125544169-125544191 GTCTTCCAGTCCATGAACATTGG + Intergenic
997048218 5:130345698-130345720 GTCTTCCAATCCATGAACATGGG + Intergenic
997391950 5:133524416-133524438 CTCTGGCAATGCAAGAAGAAAGG + Intronic
997719809 5:136069131-136069153 GTCTTCCAATTCATGAACATGGG + Intergenic
999022027 5:148176837-148176859 CTCTTACAATGCAAAAACCAAGG + Intergenic
999058625 5:148609481-148609503 GTGTTCCAATACTAGAAAAATGG + Intronic
1000806543 5:165800409-165800431 GTCTTCCAAGTCAGGAACATGGG - Intergenic
1000842575 5:166239409-166239431 CTCTTCCAATCCATGAACATGGG - Intergenic
1000943763 5:167395109-167395131 GTCTTCCAATCCATGGACATGGG + Intronic
1001578191 5:172778804-172778826 GTCACCCTATCCAAGAACAAGGG - Intergenic
1001830375 5:174781920-174781942 GTCTTCCAATACAAGAACATGGG + Intergenic
1002403243 5:179005854-179005876 ATCTTCCAATCCATGAACACAGG - Intergenic
1002651142 5:180695841-180695863 GCCTTCCAATTCACGAACATGGG - Intergenic
1002657627 5:180763706-180763728 GTCTTCCCATCCATGAACACAGG + Intergenic
1003262849 6:4537810-4537832 ATCTTCCAATCCATGAACATGGG - Intergenic
1003783953 6:9461975-9461997 GTTTTCCAATGCATGAACACAGG - Intergenic
1004438119 6:15617248-15617270 TTCTTCTAATGCATGAACATGGG - Intronic
1004737010 6:18417124-18417146 GTCTTCCAATCCATGAAGATGGG - Intronic
1005596734 6:27386286-27386308 GTCTTCCAACCCATGAACATGGG - Intronic
1006190698 6:32206573-32206595 TTCTTCCAATCCATGAACACAGG - Intronic
1007457389 6:41990321-41990343 TTCTTCCAATCCATGAACATGGG - Intronic
1008020280 6:46568999-46569021 GTCTTCCAATCCAGAAACATGGG + Intronic
1008757362 6:54812374-54812396 GTCTTCTAATCCATGAACATGGG + Intergenic
1008778333 6:55068929-55068951 GTCTTCCAATCCATGAACACGGG + Intergenic
1008967693 6:57330120-57330142 GTCTTCCAATCCATGAACATGGG + Intronic
1009352788 6:62703142-62703164 TTCTTCCAATTCATGAACACTGG + Intergenic
1010268435 6:73893053-73893075 TTCTTCCAATCCATGAACACAGG + Intergenic
1011087982 6:83563880-83563902 GTCTTCCAACCCATGAACAAAGG - Intronic
1011300734 6:85870431-85870453 GTCTTCCAATTCATGAACATAGG + Intergenic
1011764224 6:90602347-90602369 GTATTGCAATGCAAGTACTAGGG - Intergenic
1011937139 6:92794100-92794122 GTCTTCCAATCCATGAGCATGGG + Intergenic
1011943904 6:92876845-92876867 TTCTTCCAATCCATGAACATGGG + Intergenic
1011989867 6:93500861-93500883 GTCTTCCAATGCAAGACTATAGG - Intergenic
1012154526 6:95800801-95800823 TTCTTCCAATCCATGAACATGGG + Intergenic
1012345210 6:98177379-98177401 TTCTTCCAATCCATGAACATGGG - Intergenic
1012368636 6:98475268-98475290 TTCTTCCAGTGAATGAACAAGGG - Intergenic
1012402227 6:98850716-98850738 TTCTTCCAATCCATGAACACAGG - Intergenic
1012620289 6:101336074-101336096 TTCTTCCAATCCATGAACATAGG + Intergenic
1012946997 6:105477128-105477150 TTCTTCCAATCCATGAACATGGG + Intergenic
1014034160 6:116746002-116746024 TTCTTCCAATCCATGAACACAGG + Intergenic
1014120265 6:117716767-117716789 TTCTTCCAATTCATGAACATGGG + Intergenic
1014165635 6:118221265-118221287 GTCTGTAAATGCAACAACAAGGG + Intronic
1014865467 6:126523903-126523925 TTCTTCCAATCCATGAACACAGG + Intergenic
1014928856 6:127308979-127309001 TTCTTCCAATCCACGAACATGGG - Intronic
1015073638 6:129128612-129128634 TTCTTCCAATCCATGAACACAGG + Intronic
1015204781 6:130623763-130623785 TTCTTCCAATCCATGAACATGGG + Intergenic
1016421466 6:143888509-143888531 GTTTTCCAATCCATGAACATGGG + Intronic
1016855213 6:148662434-148662456 GTCTTCCAATCCACGAACACAGG + Intergenic
1016983265 6:149872981-149873003 TTCTTCCAATCCATGAACACAGG + Intergenic
1018052183 6:160020324-160020346 TTCTTCCAATTCATGAACATGGG - Intronic
1018229311 6:161660769-161660791 GTCTTTAAAGGCAAGAAGAATGG - Intronic
1018413193 6:163576989-163577011 GTTTTCGAATGTAAGAAGAAAGG + Exonic
1018594802 6:165467534-165467556 TTCTAGAAATGCAAGAACAAAGG + Intronic
1019131087 6:169875646-169875668 TTCTTCCAATCCATGAACATTGG + Intergenic
1020356854 7:7286799-7286821 TTCTTCCAATCCATGAACATAGG - Intergenic
1020504837 7:8972250-8972272 TTCTTCCAATTCAAAAACACAGG + Intergenic
1020732655 7:11902916-11902938 TTCTTCCAATCCATGAACATAGG - Intergenic
1020776867 7:12465113-12465135 GTCTTCCAATCCATGAACTTGGG + Intergenic
1021045970 7:15923781-15923803 TTCTTCCAATTCATGAACATGGG - Intergenic
1021326483 7:19275797-19275819 GTCTTCCAATCCATGAACATGGG + Intergenic
1021557597 7:21937168-21937190 GCCTTCCAATCCATGAACATGGG - Intronic
1022840356 7:34158356-34158378 GTCTTCCACTGCATGAAGACAGG + Intergenic
1023213624 7:37834989-37835011 GTCTTCCAATCCATGAACATGGG + Intronic
1023597604 7:41848335-41848357 TTCTTCCAATCCATGAACATAGG + Intergenic
1023934721 7:44731306-44731328 GTCTTCCAATCCATGGACATGGG - Intergenic
1024408741 7:49014302-49014324 GTCTTCCTATCCAAGAGCATGGG - Intergenic
1024593335 7:50909749-50909771 GTCTTCCAACCCATGAACACAGG - Intergenic
1024826123 7:53391606-53391628 ATCTTCCAATCCATGAACATAGG + Intergenic
1026598997 7:71758248-71758270 TTCTTCCAGTGCATGTACAAAGG + Intergenic
1026696278 7:72595849-72595871 GTCTTTCAATCCATGAACATGGG - Intronic
1026879083 7:73897273-73897295 GCCTTCCAATCCATGAACATGGG - Intergenic
1026883995 7:73926678-73926700 GTTTTCCAATCCATGAACATGGG + Intergenic
1026887192 7:73958124-73958146 GTCTTCCAATCCATAAACACAGG + Intergenic
1027147725 7:75708966-75708988 ATCTTCCAATCCATGAACATGGG + Intronic
1027429928 7:78101078-78101100 TTCTTCCAATCCATGAACACAGG - Intronic
1027999079 7:85468035-85468057 GGCTTCCAGTGCCAGAGCAATGG + Intergenic
1028195160 7:87898316-87898338 ATCTTCCAATTCATGAACATGGG - Intronic
1028595249 7:92541580-92541602 TTCTTCCAATTCATGAACATGGG - Intergenic
1029225609 7:99026129-99026151 GTCTTCCAATCTATGAACATGGG - Intergenic
1029245668 7:99199109-99199131 GTCTTCCAGTCCATGAACATGGG - Intronic
1029804259 7:102979867-102979889 GTCTTCCAATCCATGAACATGGG - Intronic
1030089529 7:105845419-105845441 GTCTTCCAACGCATGAACATGGG - Intronic
1031284470 7:119847314-119847336 GTCTTCCAATCCACAAACACAGG - Intergenic
1031802658 7:126268298-126268320 GTCTTCCAACCCATGAACACAGG - Intergenic
1031902092 7:127422255-127422277 TTCTTCCAATTCATGAACACGGG - Intronic
1032330330 7:130973237-130973259 GTCTTTCAATCCATGAACATGGG - Intergenic
1033632033 7:143168056-143168078 GTCTTCCAATCCATGAACACAGG + Intergenic
1033774766 7:144596560-144596582 TTCTTCCAATTCAAGAACATGGG - Intronic
1034209162 7:149347941-149347963 GTCTTCCAATCCATGAACATGGG - Intergenic
1034712871 7:153210572-153210594 GTCTTCCAATCCATGAACATGGG + Intergenic
1034840919 7:154395368-154395390 GTCTTCCCATCCATGAACATGGG + Intronic
1034892038 7:154849293-154849315 TTCTTCCAATCCATGAACAAGGG + Intronic
1034905168 7:154938211-154938233 GTCTTCCAATCCATGAACATGGG + Intronic
1035046000 7:155966085-155966107 GTCTTTCAATCCATGAACATGGG - Exonic
1035151832 7:156880561-156880583 ATCTTCCAATCCATGAACATAGG - Intronic
1035235062 7:157491741-157491763 GTCTTTCAATCCATGAACATGGG + Intergenic
1035560452 8:600426-600448 GTCTTAGAAGCCAAGAACAATGG - Intergenic
1036729745 8:11251803-11251825 GTCTTCCAATCCATGAACACAGG - Intergenic
1036828899 8:12004969-12004991 GTCTTCCAATTCACGAACATAGG + Intergenic
1036834132 8:12044919-12044941 GTCTTCCAATTCACGAACATAGG + Intergenic
1036855976 8:12291484-12291506 GTCTTCCAATTCACGAACATAGG + Intergenic
1037161921 8:15783229-15783251 TTCTTCCAATCCATGAACATGGG - Intergenic
1037291325 8:17351975-17351997 GTCTTCCAGTGCATGAACACAGG - Intronic
1037489207 8:19380975-19380997 GTCTTCTAATCCAGGAACATGGG + Intronic
1038001236 8:23393084-23393106 GTCTTCCAGTCCATGAACATGGG - Intronic
1038032730 8:23658255-23658277 GTCTTCCATTCCATGAACATGGG + Intergenic
1038322961 8:26546105-26546127 GTCTTCCAATCCATGAACTTGGG + Intronic
1038405257 8:27317411-27317433 GTCTTCCAATCCATGAACACAGG + Intronic
1038570062 8:28654000-28654022 GTCTTCCAATCCATGAACATGGG + Intronic
1038877896 8:31571955-31571977 GTCTTCCAATCCACAAACATAGG - Intergenic
1039597262 8:38801834-38801856 ATCTTCCAATTCATGAACATGGG + Intronic
1039739412 8:40368388-40368410 GTCTTCCAATCCATGAAAACAGG - Intergenic
1039749856 8:40468038-40468060 TTCTTCCAATCCATGAGCAAGGG - Intergenic
1039934223 8:42026387-42026409 TTCTTCCAATCCATGAACAGGGG + Intronic
1041101725 8:54402755-54402777 CTCTTCCAATCCATGAACATGGG - Intergenic
1041273565 8:56133698-56133720 GTCTTCCAATCCATGAACCGTGG - Intergenic
1041735071 8:61102215-61102237 GTCTTCCAATTCATGAATATGGG + Intronic
1041826606 8:62101945-62101967 GACTTCCAAAGCAGGAAGAAAGG + Intergenic
1041845834 8:62327893-62327915 GTCTTCCAATTCATGAACATGGG + Intronic
1041940253 8:63379570-63379592 GTCTTCCATTTCATGAACATGGG + Intergenic
1042152823 8:65807151-65807173 GTTTTCCAATCCATGAACATGGG + Intronic
1042587559 8:70358136-70358158 GTCTCCTAATGCATGAACAGAGG - Intronic
1042628906 8:70793960-70793982 GTCTTCAAATCCATGAACACAGG + Intergenic
1042929455 8:73998788-73998810 GTCTTCCAATCTATGAGCAAGGG + Intronic
1043276175 8:78396466-78396488 GTCTTGCAATTCATGAACACAGG + Intergenic
1043470684 8:80559347-80559369 GCCATCCCATGCAACAACAAGGG + Intergenic
1043840492 8:85097796-85097818 GTCTTCCAATTAATGAGCAAGGG - Intergenic
1044963365 8:97552676-97552698 GTCTTCCAAAGCAGAAACATTGG - Intergenic
1045075362 8:98560559-98560581 GTCTTCAAATTCATGAACATGGG - Intronic
1045157613 8:99494319-99494341 ATCTTCCAATGTATGAACACTGG + Intronic
1045191103 8:99884870-99884892 GTATTCCAATCCATGAACACAGG - Intronic
1046164250 8:110409185-110409207 TTCTTCCAATCCATGAACACAGG + Intergenic
1046209750 8:111054263-111054285 ATCTTCCAATGCATGTACATGGG + Intergenic
1046517426 8:115281565-115281587 GTTTTCCAATTCAGGAACATGGG - Intergenic
1046985666 8:120385578-120385600 TTCTTCCAATTCATGAACATAGG - Intronic
1047265456 8:123303329-123303351 GTCTTCTAATCCATGAACATGGG + Intergenic
1048129847 8:131683530-131683552 TTCTTCCAATCCATGAACACAGG - Intergenic
1048374210 8:133808155-133808177 ATCTTCCAATGGGAGAACTAAGG + Intergenic
1048996590 8:139798117-139798139 GTCTTCCAATCCATGAACACAGG + Intronic
1049333145 8:142065676-142065698 GCCTTCCAATTCCAGAACCACGG + Intergenic
1049390518 8:142367141-142367163 GTCATTCTATTCAAGAACAAGGG - Intronic
1049984681 9:938390-938412 GTCTTCCAGTCCATGAACACGGG + Intronic
1050045797 9:1543898-1543920 TTCTTCCAATGCATGAGCATGGG + Intergenic
1050108285 9:2188491-2188513 GTATTCAAATGCTAGAACAAAGG - Intronic
1050767971 9:9159582-9159604 TTCTTCCAATCCATGAACACAGG - Intronic
1050788400 9:9434389-9434411 TTCTTCCAATGCATGAACACAGG - Intronic
1051227416 9:14915665-14915687 GTCTTCCAATCCATGTACATGGG + Intergenic
1051323128 9:15932226-15932248 TTCTTCCAATCCATGAACATGGG + Intronic
1051520038 9:17976340-17976362 GTCTTCCAATTCGTGAACATGGG + Intergenic
1051704036 9:19857478-19857500 GTCTTCCAATTCATAAACATAGG + Intergenic
1051779728 9:20676769-20676791 TTCTTCCAATCCATGAACAGAGG - Intronic
1052530289 9:29674515-29674537 TTCTTCCAATCCATGAACATGGG + Intergenic
1052627386 9:30994181-30994203 TTCTTCCAATTCAAGAATATGGG - Intergenic
1053263363 9:36691292-36691314 GTTTTCCAATCCATGAACATGGG - Intergenic
1053563459 9:39221411-39221433 TTCTTCCAATCCATGAACATGGG + Intronic
1053829244 9:42059333-42059355 TTCTTCCAATCCATGAACATGGG + Intronic
1054133688 9:61397655-61397677 TTCTTCCAATCCATGAACATGGG - Intergenic
1054601315 9:67128114-67128136 TTCTTCCAATCCATGAACATGGG - Intergenic
1055362437 9:75507570-75507592 GTCTTCTAATCCATGAACATGGG + Intergenic
1055447697 9:76399176-76399198 GCCATCCCATGCAACAACAAGGG + Intergenic
1055534935 9:77230865-77230887 GTCTTCCAATCCATGCACATTGG + Intronic
1055842714 9:80525127-80525149 GTCTTCCAATCCATGAACACAGG - Intergenic
1055855632 9:80683967-80683989 GTCTTCTAATCCATGAACACAGG + Intergenic
1056155246 9:83828353-83828375 GTCTTCCAATCCATGAACATAGG - Intronic
1056355241 9:85794760-85794782 GTCTTCCAATCCATGAACATGGG + Intergenic
1056482986 9:87024738-87024760 GTCTTCTAATCCACGAACAGGGG - Intergenic
1056571113 9:87815877-87815899 TTTTTCTAATGCAAGAACACAGG - Intergenic
1056635091 9:88324931-88324953 GCCATCCCATGCAACAACAAGGG + Intergenic
1057013023 9:91623914-91623936 GTATTCCAATCCATGAACATAGG + Intronic
1057015844 9:91650759-91650781 TTATTCCAATCCAAGAACATAGG - Intronic
1057104539 9:92400109-92400131 GTCATTCCATCCAAGAACAAGGG + Intronic
1057284647 9:93742170-93742192 GTCTCCCAGTTCATGAACAAAGG - Intergenic
1057532352 9:95861815-95861837 GTCTTCCAATTCATGAACACTGG + Intergenic
1057821805 9:98337363-98337385 GTCTTCCAATTCATGAACATGGG - Intronic
1058512999 9:105739833-105739855 GTCTTCCAATGTATGAACATGGG + Intronic
1058663764 9:107289833-107289855 GGCTTTCTAAGCAAGAACAATGG - Intronic
1060635299 9:125195324-125195346 GCCATCCCATGCAACAACAAGGG - Intergenic
1060703015 9:125775846-125775868 GTCTTCCAATCCATGAACATTGG + Intronic
1060731832 9:126042833-126042855 GTCTTCCAATCCATGAACATAGG + Intergenic
1061011459 9:127957486-127957508 GTCTTCCGATCCATGAACATGGG - Intronic
1061220758 9:129249744-129249766 GTCTTCTAATCCATGAACACAGG - Intergenic
1061361485 9:130145239-130145261 GTCTTCCAATCCACGAATATGGG - Intergenic
1061825186 9:133253855-133253877 TTCTTCCAATTCATGAACATGGG - Intronic
1061956581 9:133965658-133965680 TTCTTCGAATGCATGAACATGGG - Intronic
1061979296 9:134091220-134091242 TTCTTCCAATCCATGAACATAGG + Intergenic
1186541270 X:10403081-10403103 GTCTTCCAATCCAGAAACATGGG + Intergenic
1186710470 X:12190233-12190255 GTCTTCCTATCCAAGAACATGGG - Intronic
1186899212 X:14035444-14035466 TTCTTCCAATTCATGAACATGGG - Intergenic
1187196081 X:17085494-17085516 GTTGTCCAATGCATGAACACAGG + Intronic
1187504206 X:19865623-19865645 GATTTCCAATGCCAGAACAGTGG + Intronic
1187856430 X:23640656-23640678 TTCTTCCAATCCATGAACATGGG - Intergenic
1187943586 X:24405240-24405262 GTTTTCCAATACATGAACATGGG + Intergenic
1188079657 X:25821472-25821494 GTCTTCCAATGCATGAATACAGG - Intergenic
1188218628 X:27512316-27512338 TTCTTCCAATCCATGAACACGGG - Intergenic
1188864409 X:35297377-35297399 ATCTTGCAATGCATGAACAAGGG + Intergenic
1189013700 X:37073673-37073695 TTCTTCCAATCCATGAACATGGG - Intergenic
1189019974 X:37325237-37325259 TTCTTCCAATCCATGAACATGGG - Intergenic
1189128183 X:38470340-38470362 TTCTTCCAATCCATGAACACAGG + Intronic
1189145255 X:38649213-38649235 CTCTTCCCATGCAAGAATGAGGG - Intronic
1189628575 X:42926396-42926418 TTCTTCCAATCTAAGAACACGGG - Intergenic
1189670096 X:43399287-43399309 GTCTTCTAATCCATGAACATAGG - Intergenic
1189926861 X:45964245-45964267 GTCTTCCAATCCATGAACAGGGG + Intergenic
1189932283 X:46026158-46026180 GTCTTCCAATCCATGAACATAGG + Intergenic
1190105879 X:47561087-47561109 GTCTGTCAAGGCAAGACCAACGG - Intronic
1190590966 X:52000539-52000561 GTCTTCTAATCCAAAAACACAGG + Intergenic
1191016733 X:55817111-55817133 TTCTTCCAATTCAAGAGCATGGG + Intergenic
1191123493 X:56930055-56930077 TTCTTCCAATTCATGAACATGGG - Intergenic
1191126530 X:56961051-56961073 TTCTTCCAATCCATGAACATGGG - Intergenic
1191709041 X:64128954-64128976 GTGTTCCTATGCATGAACACAGG - Intergenic
1191712738 X:64168612-64168634 GTCTTCCAATTCATGAACATGGG + Intergenic
1191967195 X:66772003-66772025 TTATTTCAATCCAAGAACAATGG + Intergenic
1192122408 X:68469198-68469220 GTCTTTCAATTCATGAACATAGG - Intergenic
1192389025 X:70705412-70705434 TTCTTCCTATGCAAAAGCAATGG + Intronic
1192397620 X:70798365-70798387 GTCTTCCAATCTATGAACACAGG - Intronic
1192463023 X:71333855-71333877 GTCTTCCAATCCATGAAGACAGG + Intergenic
1192683548 X:73279981-73280003 ATTTTCCAATGCAAGAAGACTGG - Intergenic
1192725302 X:73744663-73744685 TTCTTCCAATTCATGAACATGGG + Intergenic
1192754406 X:74031642-74031664 GCCATCCCATGCAACAACAAGGG + Intergenic
1192821153 X:74647221-74647243 TTCTTCCAATCCAGGAACATGGG + Intergenic
1192845117 X:74899002-74899024 GTCTTCCAATCCATGAACGCAGG - Intronic
1192957539 X:76089100-76089122 ATCTTCCAATTCATGAACATTGG + Intergenic
1193134794 X:77958709-77958731 TTCTTCCAATCCATGAACATGGG + Intronic
1193204480 X:78731591-78731613 TTCTTCCAATCCATGAACATTGG + Intergenic
1193262862 X:79429695-79429717 TTCTTCCAATGCTTGAACACAGG + Intergenic
1193265920 X:79469157-79469179 TTCTTCCAATCCATGAACATGGG - Intergenic
1193439800 X:81525708-81525730 TTCTTCCAATGCATGAGCAGTGG + Intergenic
1193642129 X:84022492-84022514 GTCTTTCAATACATGAACATGGG + Intergenic
1193723026 X:85008867-85008889 TTCTTCCAATTCATGAACATAGG + Intronic
1193756989 X:85420714-85420736 TTCTTCCAATCCACGGACAAAGG + Intergenic
1193932280 X:87568266-87568288 GTCTTCCAATCCAGGAACACAGG - Intronic
1193943352 X:87703731-87703753 GCCATCCCATGCAACAACAAGGG - Intergenic
1193992514 X:88325484-88325506 TTCTTCCAATCCATGAACATAGG + Intergenic
1194178714 X:90687313-90687335 TTCTTCCAGTGCATGAACATGGG - Intergenic
1194401504 X:93442537-93442559 TTCTTCCAATCCATGAACATGGG - Intergenic
1194870284 X:99123079-99123101 GTTTTCCAATCCATGAACATGGG - Intergenic
1194953828 X:100156271-100156293 GCCATCCCATGCAACAACAAGGG - Intergenic
1195128733 X:101834501-101834523 GTCTTCCAATCTATGAACAAGGG + Intronic
1195203193 X:102569092-102569114 GTCTTCCAATCCAGGGACATGGG - Intergenic
1195253610 X:103072425-103072447 GTCTTCTAATCCATGAACAGAGG - Intergenic
1195632632 X:107074790-107074812 GTCTTCTAATCCATGAACACAGG - Intronic
1195736998 X:108022164-108022186 GTCTTCCAACCCATGAACATGGG + Intergenic
1196067454 X:111480487-111480509 GTCTTCTAATACATGAACATGGG + Intergenic
1196142729 X:112282608-112282630 TTCTTCCAATCCATGAACATGGG + Intergenic
1196181493 X:112695939-112695961 GTCTTCTAATCCATGAACACAGG + Intergenic
1196750330 X:119110820-119110842 GTCTTCCAATGAATGAACATGGG - Intronic
1197231651 X:124011011-124011033 GTCTTCGAATTCATGAACACAGG + Intronic
1197246079 X:124167874-124167896 GTCTTCCAATCCATGCACACAGG + Intronic
1197557945 X:127979424-127979446 GTCTTCCAATCCATGAACACAGG - Intergenic
1197643142 X:128988489-128988511 TTCTTCCAATCCATGAACATGGG + Intergenic
1197794182 X:130282895-130282917 TGCTTCAAATGCAAGAAAAATGG + Intergenic
1197895451 X:131308877-131308899 GTTTTCCAATCCATGAACACAGG - Intronic
1198171719 X:134112944-134112966 GTCTTCCAATCCATGAACACAGG + Intergenic
1198571003 X:137956917-137956939 GTATTCCAGTGCATGAAGAAAGG + Intergenic
1198629746 X:138622897-138622919 TTCTTCCAATCTATGAACAAAGG + Intergenic
1199019673 X:142862975-142862997 GTCTTCCAATCTATGAACATGGG + Intergenic
1199158708 X:144581789-144581811 TTCTTCCAATCCATGAACATGGG + Intergenic
1199209551 X:145191184-145191206 GACATCAAATGCAATAACAAGGG + Intergenic
1199316639 X:146386243-146386265 CTCATCCAATAAAAGAACAAAGG - Intergenic
1199749031 X:150797448-150797470 GTCTTCTAATCCATGAACACAGG - Intronic
1199816407 X:151401627-151401649 TTCTTCCAATCCATGAACACAGG + Intronic
1199830352 X:151543678-151543700 ATCTTCCAATCCATGAACATGGG + Intergenic
1199940662 X:152624167-152624189 ATCTTCCAATCCAGGAACACAGG - Intergenic
1200291455 X:154879014-154879036 GTCTTCCAATTCATGAACACAGG - Intronic
1201052154 Y:9947174-9947196 GTCTTCCAATCTATGAACATGGG + Intergenic
1201328648 Y:12795042-12795064 GTCTTCCAAGACATGAACATGGG + Intronic
1201369029 Y:13240411-13240433 ATATTTCAATGCAAGAACAGTGG + Intergenic
1201944054 Y:19492245-19492267 GTCTTCCAATTTATGAACACAGG - Intergenic