ID: 1113158575

View in Genome Browser
Species Human (GRCh38)
Location 13:107353216-107353238
Sequence CAATTTTATTAGTGTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 1, 2: 2, 3: 52, 4: 386}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113158575 Original CRISPR CAATTTTATTAGTGTGCAGG AGG (reversed) Intronic
902971225 1:20052830-20052852 CATTTATCTTAGTGGGCAGGGGG - Intronic
906011635 1:42532678-42532700 CAAATTTACTTTTGTGCAGGGGG + Intronic
906853289 1:49276860-49276882 CAAATTTATTAATGTGCACATGG - Intronic
907808281 1:57842869-57842891 CATTTATATTAGTGTACAGTTGG + Intronic
907886970 1:58601170-58601192 CAGTTTTATTATTCTGCATGTGG + Intergenic
909535633 1:76733112-76733134 CAATTTCATTATTTTGCATGTGG + Intergenic
909883965 1:80916704-80916726 CAGTTTTCTCAGTGTGCAGTGGG - Intergenic
910564594 1:88629356-88629378 CAATCATATTAGTTTGCAGGTGG - Intergenic
910751008 1:90630729-90630751 CAATTTTATTCTTTTGCATGTGG - Intergenic
910834166 1:91491452-91491474 CAACTTTATTCGTTTGCATGTGG - Intergenic
911281354 1:95933310-95933332 CCATTTTCCCAGTGTGCAGGTGG + Intergenic
911611894 1:99967372-99967394 GAAATTTATTAGTGTACATGAGG + Intergenic
912317819 1:108682097-108682119 CAATTTTACTTCTGTGCAGAGGG - Intergenic
912730224 1:112095676-112095698 CAAATTTATTAGTGTTCACAGGG + Intergenic
912859701 1:113202742-113202764 CAATTTTACTTCTGTGCAGAGGG - Intergenic
915025923 1:152829452-152829474 CAATTTTATTATTTTGCTTGTGG + Intergenic
916386297 1:164274783-164274805 CAATTTTATTGTTTTGCAAGTGG - Intergenic
918877904 1:190073471-190073493 TAATTTTATTATTTTGCATGTGG + Intergenic
919064442 1:192675702-192675724 CAATTTCATTATTTTGCATGTGG - Intergenic
919327987 1:196133803-196133825 TAATTTTACTAGTGTAAAGGGGG + Intergenic
919471057 1:197979610-197979632 CAATTTTATTCTTCTGCATGTGG - Intergenic
919541568 1:198853074-198853096 CAATTTTATTCTTCTGCAAGTGG - Intergenic
921846997 1:219893817-219893839 CAATTTTATTCTTTTGCATGTGG - Intronic
923780365 1:237017109-237017131 CAAATTTATTAAAGTGCATGGGG - Intergenic
923868036 1:237961418-237961440 CATTTTTCTTAGTGAGCAGAGGG + Intergenic
924928890 1:248709709-248709731 TATTTCCATTAGTGTGCAGGGGG + Intergenic
1065083413 10:22149863-22149885 CAATTTTATTCTTCTGCATGTGG + Intergenic
1065167657 10:22996830-22996852 CAATTTGCTTATTGTGAAGGAGG - Intronic
1066241384 10:33539262-33539284 CCATTCTCTCAGTGTGCAGGCGG - Intergenic
1066539059 10:36424608-36424630 TATTTTTATCAGTGTGCTGGAGG + Intergenic
1067028199 10:42861883-42861905 CATTTTTATTAGACAGCAGGAGG + Intergenic
1067516897 10:46956449-46956471 CAATTTTATTATTTTGCATGTGG + Intronic
1067645355 10:48095377-48095399 CAATTTTATTATTTTGCATGTGG - Intergenic
1069163601 10:65120503-65120525 CAGTTTTATTCTTCTGCAGGGGG + Intergenic
1070992902 10:80747951-80747973 CAATTTTACTTCTGTGCAGAGGG - Intergenic
1072141305 10:92591484-92591506 CAATTTTATTTTTGCGCAGAGGG - Intergenic
1075523749 10:123164411-123164433 CAATCTTATTAGGGTGCAGAAGG + Exonic
1076108702 10:127845121-127845143 CAAATTCATTAGTTTGCAGGAGG + Intergenic
1077816416 11:5690240-5690262 CAATTTTATTTCTGTGCAGAGGG + Intronic
1077924643 11:6668810-6668832 CAATTTTATTCTTTTGCATGTGG + Intergenic
1078372883 11:10765352-10765374 TAATTTTATTTGTGTGTATGAGG + Intronic
1078870362 11:15338386-15338408 CAATTTTATTCTTTTGCATGTGG + Intergenic
1078921846 11:15837934-15837956 CAATTTCCTCATTGTGCAGGTGG - Intergenic
1079771637 11:24468305-24468327 CAATTTTATTCTTGTGCATGTGG + Intergenic
1080630433 11:34070017-34070039 CAATTTTATTATTGGTAAGGGGG + Intronic
1081210952 11:40333214-40333236 CAGTTTTATTAGTGGGTATGTGG + Intronic
1081330718 11:41796467-41796489 AAATTTTATTAATGTGCATGGGG - Intergenic
1081362867 11:42201687-42201709 CTATTTTCTAAGTGTGAAGGAGG - Intergenic
1082198118 11:49327744-49327766 CATTTTTAGTAGTGTGCTGTGGG - Intergenic
1082266994 11:50129932-50129954 CAATTTTCTGAGTCTGCAGCAGG + Intergenic
1082289095 11:50348636-50348658 CAATTTTCTGAGTCTGCAGCAGG - Intergenic
1082563498 11:54647655-54647677 CAATTTTATTCTTTTGCATGTGG + Intergenic
1082917928 11:58458845-58458867 CAATTTTATTCTTTTGCATGTGG - Intergenic
1083133560 11:60649658-60649680 CAATTTCATTATTCTGCATGTGG + Intergenic
1084002985 11:66307937-66307959 TTATTATCTTAGTGTGCAGGGGG + Intergenic
1086214187 11:84357873-84357895 CAAATTTCTTAATGTACAGGAGG + Intronic
1086829762 11:91545998-91546020 CAATTTTATTATTTTGCATGTGG - Intergenic
1086960852 11:92979038-92979060 CAACCCTATGAGTGTGCAGGGGG + Intronic
1087301064 11:96436198-96436220 CAATTTTATTCTTCTGCATGTGG + Intronic
1087458238 11:98414420-98414442 CAATTTGATTAGTGTTGAGTTGG - Intergenic
1087511236 11:99097223-99097245 CAATTTTTTTAGTGTTAGGGAGG + Intronic
1088123089 11:106393003-106393025 CAAGTCTATTAATGTGCATGGGG + Intergenic
1088992672 11:114967855-114967877 CAATTTTATTCTTCTGCATGTGG + Intergenic
1090072528 11:123556307-123556329 TTATTTTATTAGTATGCAGGTGG + Intronic
1090518747 11:127456629-127456651 CAATTTTATTATTTTGCATGTGG - Intergenic
1090550684 11:127816520-127816542 CAATTTTAACACTGTGCAGATGG + Intergenic
1091958218 12:4666583-4666605 CAATTTTATTCTTTTGCATGTGG + Intronic
1092568742 12:9698463-9698485 CAATTTTATTCTTCTGCATGTGG - Intronic
1093540376 12:20276111-20276133 CAAGTTTATTATTTTGCATGTGG + Intergenic
1093761029 12:22911013-22911035 CAATTTTATTTTTCTGCATGTGG - Intergenic
1094060323 12:26308174-26308196 CAATTTTATTATTTTGCATGTGG - Intergenic
1094759131 12:33509506-33509528 TAATTTTATTATTTTGCATGTGG - Intergenic
1095544985 12:43356283-43356305 CATTTGTATTAATGTGCATGTGG - Intronic
1096848791 12:54422183-54422205 GAATTTTAGTAGTGTGGAAGAGG + Intergenic
1096987438 12:55769828-55769850 CACTTATATTAGTCTGCAGTTGG - Intronic
1097000858 12:55875277-55875299 CAAATTTATTAATGTGCACATGG + Intergenic
1098027491 12:66220245-66220267 CAATTTTATTATTTTGTATGTGG + Intronic
1098675288 12:73283134-73283156 CGATTTTATTATTTTGCATGTGG + Intergenic
1099703293 12:86117240-86117262 CAATTTTTTCAGTATGAAGGTGG - Intronic
1099826971 12:87788928-87788950 CAATTTTATTCTTCTGCATGTGG - Intergenic
1102435979 12:112923856-112923878 CAATTTTATTCTTTTGCATGTGG - Intronic
1103864671 12:124042386-124042408 CAATTTTACTGGTGTGCTGATGG - Intronic
1104869126 12:131982074-131982096 CACTTTTCTTATTTTGCAGGAGG + Exonic
1105398601 13:20066280-20066302 CAAATTTGTGACTGTGCAGGGGG - Intronic
1105835779 13:24210458-24210480 CAATTTTATTATTTTGCATGTGG + Intronic
1106726299 13:32489845-32489867 CATTTTTCTTAGTGAGCAGTAGG - Intronic
1107181307 13:37463097-37463119 CAATTTTATTCGTCTGCATGTGG + Intergenic
1107946940 13:45427622-45427644 CAAATTTATTAATGTGCATGGGG - Intergenic
1109178287 13:59182150-59182172 CAGTTTTATCAGTGTGCAATTGG - Intergenic
1109400832 13:61826204-61826226 CAATTTTATTATTTTGCATATGG + Intergenic
1110512527 13:76367842-76367864 CAATTTTATTCTTCTGCATGTGG - Intergenic
1110564904 13:76948103-76948125 GAATTTTGTTTGTGTGCAGGTGG + Intergenic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1110652325 13:77956629-77956651 CAAATTTATTATTGTGCAGTAGG + Intergenic
1111025325 13:82513371-82513393 CAATTTTATTCTTCTGCATGTGG - Intergenic
1111027772 13:82555038-82555060 CAATTTTATTATTTTGCATGTGG - Intergenic
1111424280 13:88058800-88058822 CAATTTTACTTGTTTCCAGGTGG + Intergenic
1113158575 13:107353216-107353238 CAATTTTATTAGTGTGCAGGAGG - Intronic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1113861130 13:113488203-113488225 CAATTTGAGTAGATTGCAGGGGG - Intronic
1114374953 14:22134725-22134747 CAATTTTATTCTTCTGCATGTGG - Intergenic
1114593214 14:23888526-23888548 CAATTTTATTCTTTTGCATGTGG - Intergenic
1114681251 14:24485440-24485462 CACTTTTATTCTTGTGCAGTTGG - Intergenic
1114988248 14:28256379-28256401 CAATTTTATTATTTTGCATGTGG - Intergenic
1115595879 14:34908758-34908780 CAACTTTATTATTTTGCATGTGG - Intergenic
1116433108 14:44868968-44868990 CAATTTTATTCTTTTGCATGTGG - Intergenic
1116535984 14:46030819-46030841 CAATTTTATTCTTTTGCATGTGG + Intergenic
1116722368 14:48514988-48515010 CAATTTTATTCTTTTGCATGTGG + Intergenic
1117637493 14:57760228-57760250 CAATTTCATTATTTTGCATGTGG + Intronic
1119908763 14:78330376-78330398 GAATTTTCTTAGTGTTCTGGAGG - Intronic
1119921898 14:78454459-78454481 CAACTTTATTAGTGTGGACTGGG - Intronic
1120152444 14:81052243-81052265 CAATTTTATTTTTCTGCATGTGG + Intronic
1120938796 14:89925396-89925418 CAGTTTTATTAGTGTTAAAGAGG + Intronic
1120990112 14:90368039-90368061 AAATTGTATTAGTGGGAAGGAGG + Intergenic
1121877191 14:97464214-97464236 CAATTTTCCTAGGGTGCAGCAGG - Intergenic
1123980992 15:25602761-25602783 CAATTTCATTATTTTGCACGTGG + Intergenic
1124508512 15:30301212-30301234 CAATTTTATTCTTTTGCATGTGG + Intergenic
1124735045 15:32237449-32237471 CAATTTTATTCTTTTGCATGTGG - Intergenic
1124792523 15:32742819-32742841 CAATTTTATTCTTTTGCATGTGG - Exonic
1125358941 15:38845864-38845886 AAATTGTATTAGTGGGAAGGAGG + Intergenic
1125825276 15:42671347-42671369 CAATTTTACTTTTGTGCAGAGGG + Intronic
1126397836 15:48238079-48238101 CAATTTTCTAAGTGTGCACTTGG - Intronic
1127695821 15:61446119-61446141 CAGTTTTAGTAGAGTGCTGGGGG + Intergenic
1129922366 15:79330298-79330320 CAATTTTAATAGTTTTCTGGTGG - Intronic
1130084545 15:80766259-80766281 CAATTTAATCAGTCTGGAGGGGG + Intergenic
1130313723 15:82777013-82777035 AAATTTCATTATTCTGCAGGTGG - Intronic
1130394320 15:83488874-83488896 CATTTTTATTAGTTTTCATGGGG + Intronic
1132136717 15:99348470-99348492 CAATTTTATTCTTTTGCATGTGG + Intronic
1133861905 16:9603902-9603924 CACTTTAATTAGGGTGCAAGAGG + Intergenic
1134796738 16:17046022-17046044 CAATTTCATTCGTCTGCATGTGG + Intergenic
1135428334 16:22359416-22359438 GAATTTTAGTAGTGAGCCGGTGG - Intronic
1135979421 16:27135756-27135778 CAATTTTACTTCTGTGCAGAGGG - Intergenic
1136717372 16:32291904-32291926 CATTTTAATTTGTGAGCAGGAGG + Intergenic
1136789661 16:32958842-32958864 CAATTTCATTCCTGTGCATGTGG - Intergenic
1136835747 16:33498158-33498180 CATTTTAATTTGTGAGCAGGAGG + Intergenic
1136880151 16:33895091-33895113 CAATTTCATTCCTGTGCATGTGG + Intergenic
1136944864 16:34636967-34636989 CAAATTTATTATTTTGCAAGTGG - Intergenic
1137358423 16:47789587-47789609 CAATTTTGTTATTTTGCATGTGG + Intergenic
1137747862 16:50836445-50836467 CATATTTATTAATGTGCAGCTGG + Intergenic
1137908177 16:52347628-52347650 CAATTTTATTCCTTTGCATGTGG - Intergenic
1138725275 16:59130770-59130792 CAATTTTATTTTTCTGCATGTGG + Intergenic
1138970772 16:62140539-62140561 CAATTTTCTTACTGTTCTGGAGG + Intergenic
1139173576 16:64660784-64660806 CAATTTTATTCTTCTGCATGTGG + Intergenic
1139343144 16:66284395-66284417 CAATTTTATTCTTTTGCATGTGG - Intergenic
1140543916 16:75788260-75788282 CAAATTTATTAGTGTGCAGGTGG + Intergenic
1203009057 16_KI270728v1_random:225870-225892 CATTTTAATTTGTGAGCAGGAGG - Intergenic
1203091862 16_KI270728v1_random:1220313-1220335 CAATTTCATTCCTGTGCATGTGG - Intergenic
1203145925 16_KI270728v1_random:1798495-1798517 CATTTTAATTTGTGAGCAGGAGG + Intergenic
1142553528 17:756065-756087 CAATTTTACTTCTGTGCAGAGGG + Intergenic
1143436057 17:6926605-6926627 CAATTTTATTGTTCTGCAGGTGG - Intronic
1143715920 17:8768893-8768915 CAATTTTACTTCTGTGCAGAGGG - Intergenic
1145283586 17:21487007-21487029 CACGTTTATTAATGTGCAGATGG - Intergenic
1146227802 17:31082307-31082329 CAACTTTATTACTTTGCATGTGG + Intergenic
1147151911 17:38521492-38521514 CAATTTCATTCCTGTGCATGTGG - Intergenic
1147576652 17:41605097-41605119 TAATTTTAGTAGTGTTTAGGAGG - Intergenic
1149159831 17:53678700-53678722 CAATTTGATTGTTTTGCAGGTGG + Intergenic
1149405683 17:56348335-56348357 CAATCTTAGTAATGTCCAGGAGG - Intronic
1150000568 17:61434867-61434889 CAGTTTTATTCTTTTGCAGGTGG + Intergenic
1150900225 17:69266684-69266706 AAATTTTATTATTGTGCAGTGGG + Intronic
1151800973 17:76379587-76379609 CATTTGTATTAGTGTCCTGGTGG - Intronic
1152582889 17:81175729-81175751 CAATTTCATTATTTTGCATGTGG - Intergenic
1153011607 18:544847-544869 CAAATTTTTTACTGTGCCGGGGG - Intergenic
1153181842 18:2444243-2444265 CAAATTTATCAGTGTGCACAGGG + Intergenic
1153418091 18:4872679-4872701 CAATTTCATTATTTTGCATGTGG - Intergenic
1154337718 18:13479064-13479086 CAATTTTTTGTGTGTGCATGTGG - Intronic
1154474187 18:14737761-14737783 CATTTTAATTTGTGAGCAGGAGG + Intronic
1155415611 18:25596181-25596203 TAATTTTAGTAGTGTACAGGTGG - Intergenic
1155501563 18:26491922-26491944 CAATTTTATTGGTCTGGAGCAGG - Intronic
1155701775 18:28753867-28753889 CAATTTTATTTGTTTGCATCTGG - Intergenic
1155742084 18:29300968-29300990 CATTTTTATTTGTATGCAAGTGG - Intergenic
1158188791 18:54801891-54801913 TATTTTTTTTAGTGTGTAGGAGG + Intronic
1159244570 18:65789149-65789171 GAATTTTATTAATGTGCAGTGGG + Intronic
1159268430 18:66115331-66115353 CAATTTTATTCTTTTGCATGTGG + Intergenic
1162266648 19:9581204-9581226 CAATTTTACTTCTGTGCAGAGGG + Intronic
1163065684 19:14792407-14792429 CAGTTTTATTTCTGTCCAGGAGG - Intergenic
1164839073 19:31378976-31378998 GAATTTTGTGTGTGTGCAGGTGG + Intergenic
1166655439 19:44607839-44607861 CAATTTTATTTTTGTGCAGAGGG - Intergenic
1168481792 19:56726097-56726119 AAATTTTATTAATGAGCACGTGG - Intergenic
926033673 2:9616258-9616280 CAATTTTATTCTTTTGCATGTGG - Intronic
926875250 2:17469146-17469168 CAATTTTATTCTTCTGCATGTGG + Intergenic
927168482 2:20349341-20349363 GAATTTTCTTGGTGTGCATGAGG - Intronic
927402181 2:22724508-22724530 TAATTTTATTATTCTGCATGTGG - Intergenic
927584483 2:24288213-24288235 CAATTTCATTCTTTTGCAGGTGG + Intronic
927820891 2:26263869-26263891 CAATTTTAATAATTTCCAGGAGG - Intronic
928143449 2:28751180-28751202 CAATTTTACATGGGTGCAGGTGG - Intergenic
928354171 2:30594000-30594022 TAATTTTTTTAGTGTATAGGTGG - Intronic
930113160 2:47696176-47696198 CAAATTTATTAGCGTGCATATGG + Intronic
932282002 2:70501481-70501503 CATTTTTGTGAGTGAGCAGGAGG - Intronic
932473520 2:71982062-71982084 CAATTTAATTATTCTGCATGTGG - Intergenic
932742000 2:74298365-74298387 CAATTTTATTCTTCTGCACGTGG - Intronic
933168888 2:79103419-79103441 CAGTTTTATTAGCTTGCACGCGG - Intergenic
935520760 2:104102314-104102336 CAATTTTATTCTTCTGCATGTGG - Intergenic
938136266 2:128759915-128759937 CATTTTTTTTTGTGTGCACGTGG + Intergenic
939034834 2:137118650-137118672 CAATCTTATTAGTGCAGAGGGGG - Intronic
939566265 2:143789828-143789850 CAAATTTATTAGTGCACATGAGG + Intergenic
940018454 2:149131583-149131605 CAAATAAATTATTGTGCAGGAGG - Intronic
940214098 2:151286902-151286924 CAAATTTATTAATGTGCACAGGG - Intronic
940365254 2:152841232-152841254 CAATTTTATTCTTTTGCATGTGG + Intergenic
941867136 2:170346641-170346663 CACTTTTACTACTGTGCAGTTGG - Intronic
943397858 2:187364243-187364265 CAATCTTCTTAGAGTGGAGGTGG - Intronic
943833093 2:192487041-192487063 CAATTTTATTATTTTGCCTGGGG - Intergenic
944343116 2:198627487-198627509 AAAATTAATTAGTGTCCAGGAGG - Intergenic
944879883 2:204001970-204001992 CAAATTTATTAGAGTTCTGGAGG + Intergenic
945389856 2:209251613-209251635 CAATTTTATTCTTGTGCACATGG - Intergenic
947697871 2:232207704-232207726 CTATTTTCTTAGTGTCCAGTAGG + Intronic
1170047968 20:12107359-12107381 CAATTTTATTATTTTGCATGTGG - Intergenic
1170160942 20:13310368-13310390 CAATTTCATTCTTCTGCAGGTGG - Intergenic
1170263475 20:14439099-14439121 CAATTTTATTATTTCGCATGTGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1174788190 20:53452734-53452756 CAATATTATGTGTGTGAAGGAGG + Intronic
1175018349 20:55816171-55816193 CAATTTTATTCTTTTGCATGTGG + Intergenic
1177571338 21:22890744-22890766 CAATTCTTCTAGTTTGCAGGTGG + Intergenic
1179378524 21:40876528-40876550 CAGTTTTATTCGTTTGCATGTGG - Intergenic
1182018830 22:27063735-27063757 CTATTTTATTAATGTGCCAGAGG + Intergenic
1182399294 22:30062270-30062292 CAAATCTATTAATGTGCATGGGG + Intergenic
949144000 3:673173-673195 CAATTTTATTATTCTGCATGTGG - Intergenic
949564088 3:5229070-5229092 CACTCTTCTGAGTGTGCAGGCGG + Intergenic
949990023 3:9571074-9571096 CAAATTTATTAACATGCAGGGGG + Intergenic
951328470 3:21335480-21335502 CAATTTTATTATTCTGTATGTGG - Intergenic
951407446 3:22317723-22317745 CAAATTTATTAATGTGCATGGGG - Intronic
951773775 3:26286152-26286174 CAATTTTTTTAGTGTGTGTGAGG - Intergenic
952731818 3:36645190-36645212 CAATTTTATTATTTTGCATCTGG + Intergenic
954067205 3:48116296-48116318 CAATTTTGTTTCTGTGCAGAGGG - Intergenic
955862680 3:63348725-63348747 CAATTTTATTCTTCTGCATGTGG + Intronic
957288060 3:78242187-78242209 CAAATTTGTTAATGTGCATGGGG - Intergenic
957297057 3:78345907-78345929 CAATTTAAAAAGTGTGGAGGGGG + Intergenic
957505400 3:81114066-81114088 TAATTTTATTCATGTGCATGTGG - Intergenic
957623500 3:82626412-82626434 CATTTTTATAAGTCTGTAGGTGG - Intergenic
958252749 3:91289326-91289348 CAATTTTATTATTTTGCATGTGG + Intergenic
958719892 3:97831056-97831078 GAAATTTATTAGCATGCAGGGGG + Intronic
959028180 3:101266539-101266561 CAATTTAATAAATGTGCATGGGG - Intronic
959032175 3:101311985-101312007 TAAATTTATTAGTTTGCATGTGG - Intronic
959881489 3:111448676-111448698 TCATTTTGTTGGTGTGCAGGGGG + Intronic
960448322 3:117775672-117775694 AAATTTTATTAGTGTCCATAAGG + Intergenic
961341378 3:126223595-126223617 CAAATTTATTATTTTGCAGGTGG - Intergenic
961908632 3:130290032-130290054 CAATTTTACTATTTTGCATGTGG + Intergenic
962447190 3:135476956-135476978 CAATTTTATTCTTTTGCATGTGG + Intergenic
962973176 3:140424004-140424026 CAATTTTACTTCTGTGCAGAGGG - Intronic
963205025 3:142624922-142624944 CAATTGTATTCTTGTGGAGGAGG + Intronic
963457232 3:145559514-145559536 CAATTTTATTCTTTTGCATGTGG + Intergenic
964776599 3:160286285-160286307 CAAATTTATTAGCTTGCATGGGG + Intronic
964878873 3:161401067-161401089 CAAATGTATTAATGTGCACGAGG - Intergenic
965025337 3:163294765-163294787 CAATTTTATTCTTTTGCAGGTGG - Intergenic
965222305 3:165941916-165941938 CAAATTTATTATTTTGCATGTGG - Intergenic
965880161 3:173379706-173379728 CAATTTTATTCTTCTGCATGTGG + Intergenic
965948059 3:174266993-174267015 TAATGTTTTTAGTATGCAGGGGG - Intronic
966973065 3:185062841-185062863 CAATTTTATTCTTCTGCATGTGG - Intergenic
967627010 3:191698712-191698734 CAATTTCATTATTTTGCATGTGG + Intergenic
967678715 3:192333794-192333816 CAAATTTATTAATGTGCACTGGG + Intronic
968527227 4:1066989-1067011 CAACTTCATTATTCTGCAGGTGG + Intronic
970717302 4:18941308-18941330 CAATTTGATTAGATTGAAGGAGG + Intergenic
972053126 4:34765194-34765216 TAATTTTATTTTTGTGCAGGGGG + Intergenic
974910752 4:68116786-68116808 CAATTTTATTCTTCTGCATGTGG - Intronic
974961108 4:68701791-68701813 CAATTTTATTCTTTTGCATGTGG + Intergenic
975899221 4:79130211-79130233 CAATTTTATTCTTTTGCATGTGG + Intergenic
976033334 4:80785234-80785256 CAATTTCATTATTTTGCATGTGG + Intronic
976269392 4:83216132-83216154 CAATTTCATTCTTTTGCAGGTGG - Intergenic
977104044 4:92857550-92857572 CAATTTTATGAATGTGAAAGAGG + Intronic
977610711 4:99027235-99027257 CAAATTTATTAGTGTGCATGGGG + Intronic
978310324 4:107379950-107379972 CAATTTTACTTCTGTGCAGAGGG - Intergenic
978496633 4:109366468-109366490 AATTTTTATTACTGTGCAGAAGG + Intergenic
979064825 4:116117401-116117423 CAACTTTATTATTTTGCATGTGG - Intergenic
979358203 4:119730656-119730678 GAAATTTATTAGTGTGCACAGGG + Intergenic
979735723 4:124080685-124080707 CAACTTTATTATTTTGCATGTGG - Intergenic
979926551 4:126573596-126573618 CAATATTTTTTGTGTGCAGAGGG + Intergenic
980610560 4:135155715-135155737 CAATTTTATTCTTCTGCAAGAGG - Intergenic
980702343 4:136448710-136448732 CAAATATATTAGTGTGCATGGGG + Intergenic
981223729 4:142267507-142267529 CAATTTTATTTTTCTGCATGTGG - Intronic
981585416 4:146296309-146296331 CAATATTTTTAATCTGCAGGTGG + Intronic
983142384 4:164167719-164167741 CTATTTTATTCTTTTGCAGGTGG - Intronic
983378006 4:166954501-166954523 TAATTTTATTATTCTGCATGTGG + Intronic
983465878 4:168089173-168089195 CAATTTTATTCTTCTGCATGTGG - Intergenic
984106050 4:175547448-175547470 CAGTTTTATTAGTGTGGTGAAGG - Intergenic
984673130 4:182515115-182515137 CAATTTCAGTAGTGTTCTGGGGG + Intronic
986447633 5:7836458-7836480 CATTTTTATTAATGTGCATGGGG + Intronic
986537196 5:8802458-8802480 CAATTTTATTTTTCTGCATGTGG - Intergenic
986837375 5:11653939-11653961 CAATTTCATTATTTTGCATGTGG + Intronic
986966944 5:13285044-13285066 CAATTTTATTCTTTTGCATGTGG + Intergenic
987567906 5:19617076-19617098 CAGTTTGATTTGTGTGCAAGTGG + Intronic
987865309 5:23528600-23528622 CAATTTTACTTCTGTGCAGAGGG + Intergenic
988057560 5:26119416-26119438 AAATTTTATGAGTATGGAGGTGG - Intergenic
988193559 5:27970100-27970122 CAACTTTATTATTTTGCATGAGG - Intergenic
988484349 5:31656227-31656249 GAATTTAAGTAGTGGGCAGGTGG - Intronic
988642358 5:33055061-33055083 CAATTTTATTATTTTGTATGTGG - Intergenic
989448354 5:41557462-41557484 CAATTTTATTATTCTGCATGTGG + Intergenic
990229619 5:53698450-53698472 CAATTTCATTATTTTGCATGTGG - Intergenic
990494112 5:56329608-56329630 AAATTTTATTAATGTGCATATGG - Intergenic
991514874 5:67424260-67424282 CAATTTCATTATTTTGCATGTGG - Intergenic
992459569 5:76947807-76947829 CAATTTTATTATTTTGCACTTGG - Intergenic
992606402 5:78461372-78461394 CAATTTTATTCTTCTGCATGTGG + Intronic
993063115 5:83065009-83065031 CAGTTTTATTTCTGTCCAGGAGG + Exonic
993428244 5:87797781-87797803 TAATTTTATTAGTGTAAAAGTGG + Intergenic
993677062 5:90829114-90829136 CACTTTAATCAGTCTGCAGGTGG + Exonic
993897500 5:93554992-93555014 GAATTTTATTTGTTTGCAGGTGG - Intergenic
994551857 5:101244184-101244206 CAATTTTATTCATATGCATGTGG - Intergenic
994566460 5:101452593-101452615 CAATTTTATTCTTTTGCATGTGG - Intergenic
994731295 5:103494438-103494460 CAATTTCATTATTTTGCATGTGG + Intergenic
994794637 5:104280168-104280190 CAATTGTTTTAGGGTACAGGTGG + Intergenic
994908925 5:105876211-105876233 CAATTTTATTCTTCTGCATGTGG - Intergenic
995331658 5:110953862-110953884 CAATTCTTGTATTGTGCAGGAGG - Intergenic
995415344 5:111905083-111905105 CAAATTTATTGGTGTGCATAAGG - Intronic
996251476 5:121339615-121339637 CAATTTTATTCTTCTGCATGTGG + Intergenic
996435004 5:123424108-123424130 CAATTTGAGTAGTGTTTAGGAGG - Intergenic
996808773 5:127489679-127489701 CAATTTTAGTAATCTGCAGAAGG + Intergenic
999056315 5:148581533-148581555 CAATTTTATTACTTTGGATGTGG + Intronic
999072107 5:148754741-148754763 CAATTTTATTCTTTTTCAGGTGG + Intergenic
999346394 5:150824127-150824149 CAATTTCATTATTCTGCATGTGG - Intergenic
999858397 5:155619788-155619810 CAATTTTATTAGACTTCAGGGGG + Intergenic
999939468 5:156525778-156525800 CAATTTCATTTTTGTGCATGTGG + Intronic
1000103633 5:158038185-158038207 CAATTTTACTTCTGTGCAGAGGG + Intergenic
1000808037 5:165821979-165822001 CAATTTTATTCATTTGCATGTGG + Intergenic
1001222438 5:169913164-169913186 CAATTTCATTAGTGTTCTAGCGG + Intronic
1001623218 5:173106490-173106512 GCATTTTATTAGTGTACACGTGG - Intronic
1004091825 6:12510967-12510989 CAATTTTATTCTTCTGCATGTGG - Intergenic
1004153346 6:13142598-13142620 CAATTTCATTATTTTGCATGAGG + Intronic
1004293212 6:14387213-14387235 CAATTTTATTTTTGCGCAGAGGG + Intergenic
1005251197 6:23948440-23948462 CAATTTTATTCTTTTGCATGGGG - Intergenic
1005482081 6:26264662-26264684 CAAGTTTATTAACATGCAGGAGG + Intergenic
1005643257 6:27816888-27816910 CAAATTTATTAATGTGCATGGGG + Intergenic
1007045122 6:38765492-38765514 CAATTTTATTGTTTTGCATGTGG + Intronic
1007120232 6:39374169-39374191 CAATTTTATTCTTGAGCATGTGG - Intronic
1007215202 6:40231913-40231935 CAATTTTATGAGTTTGCATGTGG - Intergenic
1008757332 6:54811953-54811975 CAATTTTATTATTTTGCAATTGG + Intergenic
1009191730 6:60637592-60637614 CAATTTTATTATTTTGCATGTGG - Intergenic
1009313031 6:62180983-62181005 CAATTTTATTGTTGTGCATGTGG - Intronic
1009504910 6:64465542-64465564 TATTTTTATTAGTCTGCATGTGG - Intronic
1010907598 6:81510939-81510961 CAATTTTATTCTTTTGTAGGTGG + Intronic
1011675787 6:89732149-89732171 CAATTTTATTTTTGTGCAGAGGG - Intronic
1012817496 6:104042440-104042462 CAGTTTTATTATTCTGCATGGGG - Intergenic
1014307837 6:119764858-119764880 CAATTTTACTTCTGTGCAGAGGG + Intergenic
1015073619 6:129128195-129128217 CAATTTTATTCTTCTGCATGTGG + Intronic
1015831962 6:137379887-137379909 CAATTTTATTCTTTTGCATGTGG - Intergenic
1016030641 6:139333805-139333827 CAATTGTATTAGTCTGCTTGTGG - Intergenic
1016591382 6:145748235-145748257 CAAATTTATTAGTTTGCACATGG - Intergenic
1016660816 6:146577469-146577491 CAATTTTATTCTTTTGCATGTGG - Intergenic
1017065669 6:150527014-150527036 GAATTTTCAAAGTGTGCAGGGGG - Intergenic
1021192360 7:17636008-17636030 CAATTTTATTCTTCTGCATGTGG - Intergenic
1021404808 7:20252712-20252734 CAATTTTATTCTTTTGCATGTGG - Intergenic
1021721534 7:23509348-23509370 CAAAGTTATTAGTGTGCATATGG - Intronic
1022684029 7:32577954-32577976 CAAATTTGTTAATGTGCATGAGG + Intronic
1023541278 7:41269273-41269295 CAATTTTTGTAGTGTTCTGGTGG - Intergenic
1023646490 7:42322271-42322293 AAATTTCATTAGTCTGCATGTGG + Intergenic
1023706003 7:42942481-42942503 CAATTTGATTTGTGTCAAGGTGG - Intronic
1024108761 7:46122687-46122709 TAATTTTATTATTTTGCATGTGG + Intergenic
1024451931 7:49557128-49557150 CAATTTCATTCTTGTGCATGTGG - Intergenic
1024776613 7:52794872-52794894 CAATTTTATTCTTCTACAGGTGG - Intergenic
1024778202 7:52813628-52813650 CAATTTTATTATTTTGCAGATGG + Intergenic
1024819091 7:53305986-53306008 CAAATTTATTAGTGTGCATGGGG - Intergenic
1024835705 7:53515565-53515587 CCATTTTACTAATGTTCAGGGGG + Intergenic
1028084590 7:86620308-86620330 TAATTTTATTATTCTGCATGTGG + Intergenic
1028557530 7:92139689-92139711 CAAATTTATTATTTTGCTGGTGG + Intronic
1028842256 7:95441264-95441286 CAGCTTTATCAGTATGCAGGTGG + Intergenic
1029025490 7:97412947-97412969 CAAATTTATTAGAGTGCATGGGG + Intergenic
1029623387 7:101704077-101704099 CAGTTTTATTTGTTTCCAGGTGG - Intergenic
1030391646 7:108935464-108935486 CAATTTAATTATTTTGCATGTGG - Intergenic
1030501041 7:110359028-110359050 CAATTTTATCATTTTGCATGTGG + Intergenic
1031417706 7:121512308-121512330 CAAATTTATTAATGTGCACATGG - Intergenic
1031462972 7:122074672-122074694 CAATTTCATTATTTTGCATGTGG + Intergenic
1031764165 7:125755240-125755262 CAATTTTATTATTTTGCATATGG + Intergenic
1031825975 7:126565979-126566001 CAGTTTTATTCCTGTGCATGTGG - Intronic
1032770408 7:135048050-135048072 CAATTTTATTCTTTTGCATGTGG + Intronic
1032885098 7:136128988-136129010 CAATTTTATTAGCCTGCAGTTGG + Intergenic
1033658832 7:143390312-143390334 CTATTTTATTAGGGTGGTGGTGG + Intronic
1036214601 8:6868620-6868642 CACTTTTAGTAGTGGCCAGGAGG - Intergenic
1037044334 8:14278282-14278304 CAAATTTATTTATGTGCACGTGG - Intronic
1038074951 8:24061782-24061804 CAATTTCATTACTTTGCAGGTGG - Intergenic
1038138319 8:24814708-24814730 CAGATTTATGACTGTGCAGGGGG + Intergenic
1038630415 8:29237938-29237960 TAATTTTATTAGAGTACAGTGGG - Intronic
1038943722 8:32334030-32334052 CAAGTTTTTAATTGTGCAGGAGG - Intronic
1039266983 8:35836262-35836284 CAATTTCATTTTTCTGCAGGAGG - Intergenic
1039302287 8:36222330-36222352 CAAATTTGTTAGTGTGCATGGGG - Intergenic
1039419079 8:37420472-37420494 CATTATTATCAGTGGGCAGGCGG - Intergenic
1039641749 8:39230399-39230421 CAATTTTATTAGTCTACGTGTGG - Intronic
1041680994 8:60591186-60591208 GAATTTTATTAGTGGGGGGGAGG - Intronic
1041868007 8:62598873-62598895 TAATTTAAATAGTGAGCAGGTGG - Intronic
1043067112 8:75587995-75588017 CAATTTTATTGTTCTGCATGTGG + Intergenic
1043295863 8:78663113-78663135 AAATTTTCTAAGTGTTCAGGGGG - Intergenic
1043386452 8:79752784-79752806 CAATTTCATTCTTGTGCATGTGG - Intergenic
1043715274 8:83476387-83476409 CAATTTTATTCTTCTGCATGTGG - Intergenic
1044009545 8:86976426-86976448 CAACTTTATTATTCTGCATGTGG + Intronic
1044765481 8:95568330-95568352 CAATTTCATTATTTTGCATGAGG + Intergenic
1045856941 8:106775361-106775383 CAATTTTATTCTTTTGCATGTGG + Intergenic
1046331954 8:112728734-112728756 CAAATTTATTAATGTGCACGTGG - Intronic
1046341812 8:112868806-112868828 CAATTTCATTATTTTGCAAGTGG - Intronic
1046659113 8:116929456-116929478 CAAATTTATTAATGTACAGGGGG - Intergenic
1046725060 8:117665203-117665225 CAAATTTATTAGCGTACATGGGG + Intergenic
1047427929 8:124763587-124763609 CAATTTTATTTTTGGGCAGAGGG - Intergenic
1047681856 8:127262090-127262112 CAATTTTATTCTTCTGCATGTGG + Intergenic
1048681831 8:136851160-136851182 CAATTTTATACGTTTGCAGAAGG - Intergenic
1049948589 9:622541-622563 CAATTTTATTTTTTGGCAGGTGG - Intronic
1050632126 9:7571244-7571266 CAATTCTATTAGTGTAGAAGTGG + Intergenic
1050929825 9:11308785-11308807 CCATTTTGCCAGTGTGCAGGAGG - Intergenic
1051012022 9:12428409-12428431 CAGTTTTATTATTTTGCATGTGG - Intergenic
1051113669 9:13669486-13669508 CAATTTTATTCATTTGCATGTGG - Intergenic
1051165874 9:14261555-14261577 TAAATTTATTAGTGTGCAAGGGG + Intronic
1051714417 9:19966604-19966626 CATTTTTATTAGTGAGAATGTGG - Intergenic
1052266955 9:26585733-26585755 TAATTTTATTCTTCTGCAGGTGG + Intergenic
1052713595 9:32088108-32088130 CAAATTTATTAATGTGCACGGGG - Intergenic
1053044903 9:34907402-34907424 CAAGTTTATTAATGTGCATGAGG - Intergenic
1055270939 9:74557561-74557583 TGATTATATTAGTGTGCATGAGG - Intronic
1055282148 9:74687067-74687089 TAATTTCATTGGTGAGCAGGTGG - Exonic
1056033497 9:82579350-82579372 CAACTTTATTAATTTGCATGTGG + Intergenic
1057241246 9:93412067-93412089 CAATTTTATTCCTTTGCATGTGG + Intergenic
1059886788 9:118753484-118753506 CAATTTTATTCTTTTGCATGTGG - Intergenic
1059889310 9:118783688-118783710 CATTTTTCTTAGGGTGAAGGGGG + Intergenic
1059924271 9:119192045-119192067 CAATGTCATTAGTCTGCATGGGG - Intronic
1060423687 9:123487365-123487387 CAATAATATTGGTGTGGAGGGGG - Intronic
1062758970 9:138327318-138327340 CAATTATAGTAGTGTGTAGAGGG - Intergenic
1186816573 X:13243638-13243660 CAAATTTATCAGTGTGCACATGG + Intergenic
1186823220 X:13312666-13312688 CAATGATGTTAGTGAGCAGGTGG + Intergenic
1187777518 X:22778942-22778964 CAATTTTATTCTTTTGCATGTGG + Intergenic
1188236168 X:27733726-27733748 CAATTTCATTATTTTGCATGTGG + Intronic
1188655558 X:32690785-32690807 CAATTTCATTATTTTGCACGTGG - Intronic
1188747993 X:33870969-33870991 CAATTTCATTATTGTGCATATGG + Intergenic
1189123368 X:38419033-38419055 CAATTTTATTTTTCTGCATGTGG + Intronic
1189182694 X:39018553-39018575 CAATTTTGTGGGTGAGCAGGTGG + Intergenic
1189434218 X:40977068-40977090 AAATTTTATTGGTGTGGATGTGG - Intergenic
1189959350 X:46309584-46309606 AAATTTTATTAATGTGCATATGG + Intergenic
1190490481 X:50978153-50978175 CAATTTTACTTCTGTGCAGAGGG + Intergenic
1192188242 X:68971960-68971982 CAATTTCATTCTTGTGCATGTGG - Intergenic
1192279170 X:69665501-69665523 CAATTTTATTCTTTTGCACGTGG + Intronic
1192716307 X:73646085-73646107 CAATTTTATTCCTCTGCATGTGG + Intronic
1193589528 X:83370963-83370985 CAATTTTATTATTTTGCATGTGG + Intergenic
1193880324 X:86913096-86913118 CAATTTTATTACTGTACACATGG + Intergenic
1194073518 X:89358924-89358946 CAATTTTATTATTTTGCTTGTGG + Intergenic
1194129788 X:90067072-90067094 CAAATTTATTAGCATGCAAGGGG - Intergenic
1194151594 X:90331589-90331611 CAATTCTGTTATTGTGGAGGAGG - Intergenic
1194476296 X:94363704-94363726 AAATTTTATTACTATGCATGAGG - Intergenic
1194921338 X:99769482-99769504 CAATTTTATTCTTTTGCATGTGG - Intergenic
1195033857 X:100952948-100952970 CAACTTAATTATTTTGCAGGTGG - Intergenic
1195816011 X:108888995-108889017 CAATTTTATTCTTTTGCATGCGG - Intergenic
1197059088 X:122155173-122155195 CAACTTTATTATTTTGCATGTGG - Intergenic
1197367032 X:125576162-125576184 CAATTATCTTTGTTTGCAGGTGG + Intergenic
1197599572 X:128512128-128512150 CAATTTTATTGTTTTGCATGTGG - Intergenic
1198195919 X:134361839-134361861 CAATTTTATTCTTTTGCATGTGG - Intergenic
1199305104 X:146258601-146258623 TATTTTTATTAGTGTGTAGAAGG + Intergenic
1199964611 X:152809487-152809509 CAATTTCATTATTTTGCATGTGG + Intergenic
1200497957 Y:3908336-3908358 CAATTCTGTTATTGTGGAGGAGG - Intergenic
1200728901 Y:6710501-6710523 CAATTTTATTATTTTGCTTGTGG + Intergenic
1201973141 Y:19817538-19817560 CAATTTTACTTCTGTGCAGAGGG + Intergenic
1202356969 Y:24061998-24062020 CAAGTTTATTTGTGTAGAGGTGG - Intergenic
1202513808 Y:25608116-25608138 CAAGTTTATTTGTGTAGAGGTGG + Intergenic